معلومة

هل من المرجح أن يتدخل الحمض النووي الصبغي في رسم خرائط التقييد أو تحليل تفاعل البوليميراز المتسلسل في الإشريكية القولونية؟

هل من المرجح أن يتدخل الحمض النووي الصبغي في رسم خرائط التقييد أو تحليل تفاعل البوليميراز المتسلسل في الإشريكية القولونية؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

نحن نصنف YADH-1 في دورة معمل الكيمياء الحيوية. على مدار الأسابيع الأولى ، حصدنا خلايا الإشريكية القولونية ، وعزلنا DNA البلازميد عن طريق تحلل الخلايا القلوية. طرح اختبار سابق للدورة السؤال التالي بشأن تحليل DNA البلازميد:

"هل من المرجح أن يتدخل الحمض النووي للكروموسومات في رسم خرائط التقييد ، أو مع تحليل تفاعل البوليميراز المتسلسل ، أو من المحتمل بنفس القدر أن يتداخل مع كلتا الطريقتين؟"

نظرًا لأننا نستخدم EcoRI و BamHI ، فإن عملية تفكيري هي أنه بينما يمكننا توقع التخفيضات على بلازميد دائري ، فلن نكون قادرين على التنبؤ بكل التخفيضات على الحمض النووي للكروموسومات عالي الوزن الجزيئي ، وخريطة التقييد الناتجة سيكون عديم الفائدة. ومع ذلك ، يمكن أن يعمل تفاعل البوليميراز المتسلسل في خليط معقد من الجزيئات ، لذلك حتى في الحمض النووي الكروموسومي ، يجب أن تكون البادئات قادرة على إيجاد التسلسل المستهدف. هل الجواب إذن هو أن الحمض النووي للكروموسومات يتدخل على الأرجح في رسم خرائط التقييد؟


مرحبا بكم في علم الأحياء.

أعتقد أنك توصلت إلى نتيجة معقولة ، ولكن ليس للأسباب الصحيحة تمامًا.

جينومات العديد من سلالات الإشريكية القولونية تم تسلسلها (على سبيل المثال https://www.ncbi.nlm.nih.gov/nuccore/U00096) حتى تتمكن من التنبؤ بأحجام الأجزاء التي تتوقعها من الملخص الخاص بك.

حجم الجينوم بكتريا قولونية حوالي 4.6 مليون زوج أساسي وستة قواطع مثل EcoRI و BamHI في المتوسط مرة واحدة تقريبًا كل 4096 نقطة أساس (يجب أن تكون قادرًا على معرفة كيفية التوصل إلى هذا الرقم). من ذلك ، ماذا تتوقع أن ترى إذا كنت قد أجريت هضمًا مقيدًا على الحمض النووي الجيني لهذه البكتيريا؟

هل يساعدك ذلك في تحسين إجابتك؟

(إذا كان لديك وصول إلى البرنامج المناسب ، فأنا أشجعك على تنزيل هذا التسلسل والتحقق من استنتاجاتك.)

((لاحظ أيضًا أن خصوصية PCR تعتمد على اختيار التمهيدي ، لذا فإن إجابتك تفترض أن البادئات مصممة جيدًا!))


  • من المتوقع أن يصف الاستراتيجيات المتضمنة في تسلسل الجينوم الميكروبي والجينوميات الوظيفية
  • قدم أمثلة على المعلومات التي يمكن اشتقاقها من علم الجينوم

تسلسل الجينوم الميكروبي

  • مشاريع تسلسل الجينوم
    • استراتيجية وطرق أمبير
    • حاشية. ملاحظة
    • منظمة
    • المحتوى الجيني
    • نسخة
    • بروتين
    • طفرة على مستوى الجينوم

    مشاريع تسلسل الجينوم

    تقدم تسلسل الجينوم (2009)

    • مكتمل:
      • الأثرية: 70 (2007 = 49) (2008 = 55)
      • البكتيريا: 945 (2007 = 554) (2008 = 728)
      • (حقيقيات النوى: 121) (2007 = 76) (2008 = 97)
      • الأثرية: 111
      • البكتيرية: 3498
      • (حقيقيات النوى: 1223)
      • مشاريع الميتاجينوم: 200

      مشاريع الجينوم البكتيرية

      • المستدمية النزلية
      • الإشريكية القولونية
      • العصوية الرقيقة
      • المفطورة التناسلية
      • هيليكوباكتر بيلوري (x2)
      • العطيفة الصائمية
      • اللولبية الشاحبة
      • النيسرية menigitidis
      • النيسرية جونورهويا
      • ضمة الكوليرا
      • الإشريكية القولونية O157

      تم الانتهاء من مشاريع حقيقيات النوى الميكروبية

      • خميرة -خميرة الخميرة
      • المتصورة المنجلية
      • Aspergillus nidulans، A.niger، A.oryzae & amp A.fumigatus
      • المثقبية الكروزية وأمبير بروسي
      • الليشمانيا
      • المتحولة الحالة للنسج
      • جيارديا لامبليا
      • المبيضات البيض & amp glabrata
      • باراميسيوم

      استراتيجية تسلسل الجينوم

      في عصر ما قبل الجينوم ، كان هناك عدد من الاعتبارات المتعلقة بفوائد التسلسل. كانت المجموعة المجزأة من الجينات المتسلسلة بطيئة ومكلفة. نشأت أيضًا مشكلات حول الملكية ، واختيار الإجهاد ، والنهج ، وإصدار البيانات. ومع ذلك ، قدم مشروع الجينوم نهجًا عقلانيًا للتسلسل كان فعالًا وسريعًا ، وكان قادرًا على معالجة أسئلة جديدة. سمح عصر ما بعد الجينوم بتطبيق علم الجينوم المقارن والوظيفي.

      استراتيجية تسلسل الجينوم:
      • اختيار الاستراتيجية
        • مشاريع تعاونية كبيرة قائمة على cosmid / BAC
          • الآن أكثر ملاءمة للجينومات الأكبر
          • بطيء
          • مركزية
          • سريع وفعال
          • اختيار البكتيريا
          • عزلة جديدة مقابل سلالة معملية
          • السريرية مقابل البيئية
          • التحليل الجيني اللاحق

          على سبيل المثال استراتيجية تسلسل جينوم الخميرة

          • كروموسومات الخميرة (16) متسلسلة بشكل فردي
          • عدة طرق مستخدمة
            • إنشاء مكتبة الجينوم في الكون
              • طلب مكتبة cosmid
                • بحاجة إلى معرفة الكوسميد الذي يتداخل مع
                      • تسلسل فقط الحد الأدنى من العدد
                      • استخدم مسبارًا محددًا للكروموسوم لتحديد الكوسميدات الخاصة بالكروموسوم
                      • يُدرج التسلسل cosmid عن طريق الاستنساخ الفرعي
                      • حل المشكلات عن طريق تسلسل تفاعل البوليميراز المتسلسل المباشر والمشي والمكتبات الأخرى (لامدا)
                      • التيلوميرات
                      استراتيجية بندقية الجينوم / الكروموسوم الكاملة (WGS)
                      • سريعون
                      • جيل من مكتبة الجينوم إدراج صغيرة
                      • لم يتم طلب المكتبة في البداية
                      • نهايات تسلسل الحمض النووي للإدخالات
                      • يعتمد على الحوسبة القوية لتجميع قراءات التسلسل
                      الخطوات الرئيسية لتوليد تسلسل الجينوم الكامل

                      أجهزة التسلسل الآلي:

                      يتطلب تسلسل إنهاء السلسلة يدويًا أربعة أنابيب تفاعل تحتوي كل منها على نوع مختلف من قاعدة النهاية بالإضافة إلى نيوكليوتيد مشع لتسمية شظايا الحمض النووي المركب حديثًا. يتم إرسال كل تفاعل من التفاعلات الأربعة بالكهرباء في حارة منفصلة من مادة هلامية. أدى الطلب على القدرة على قراءة المزيد من التسلسل في فترة زمنية أقصر إلى أتمتة عملية تسلسل الحمض النووي.

                      ضمّن إرفاق الأصباغ الفلورية المختلفة بكل من قواعد الفصل الأربعة أن أربعة تفاعلات تسلسلية منفصلة لم تعد مطلوبة ، ويمكن إنجاز تفاعل التسلسل بالكامل في أنبوب واحد. أدى تطوير آلات التسلسل الآلي هذه باستخدام عدة شعيرات دموية ، وأنابيب زجاجية رفيعة مجوفة مملوءة ببوليمر هلامي ، إلى إزالة الحاجة إلى فني لإضافة كل تفاعل تسلسلي إلى ممر فردي للجيل قبل التشغيل

                      تعد ABI 3700s (التي تصنعها شركة Applied Biosystems) أكثر أجهزة التسلسل الآلي استخدامًا. لديهم 96 من الشعيرات الدموية ، مع روبوت يتم تحميله من 384 لوحًا جيدًا.

                      صُنع MegaBACE بواسطة Amersham. كما أن لديها 96 شعيرات دموية وتحميل آلي من صفيحة 384 بئر. تستغرق كل عملية تشغيل من ساعتين إلى أربع ساعات ، ويمكن قراءة ما يصل إلى 800 قاعدة.

                      أدت هذه التطورات إلى تصنيع التسلسل. تقسم معظم مشاريع تسلسل الجينوم المهام (مثل مكتبات الجينوم وتسلسل الإنتاج والتشطيب) بين فرق مختلفة. تعمل آلات التسلسل على مدار 24 ساعة في اليوم و 7 أيام في الأسبوع ويمكن تنفيذ العديد من المهام بواسطة الروبوتات.

                      454 التسلسل- المستقبل؟

                      تم تطوير التسلسل 454 من شركة روش ، ويعتمد على تقنية تعرف باسم التسلسل الحراري (التسلسل بالتوليف). وهو يختلف عن تسلسل سانجر ، بالاعتماد على الكشف عن إطلاق بيروفوسفات على دمج النيوكليوتيدات ، بدلاً من إنهاء السلسلة باستخدام ديديوكسينوكليوتيدات.

                      • تتدفق النيوكليوتيدات بالتتابع بترتيب ثابت عبر جهاز PicoTiterPlate أثناء تشغيل التسلسل.
                      • أثناء تدفق النوكليوتيدات ، يتم تسلسل مئات الآلاف من الخرزات التي تحمل كل منها ملايين النسخ من جزيء DNA وحيد الخيط بشكل متوازٍ.
                      • إذا تم تدفق نيوكليوتيد مكمل لقالب القالب في بئر ، فإن البوليميراز يمد حبلا DNA الموجود عن طريق إضافة نيوكليوتيدات.
                      • تؤدي إضافة واحد (أو أكثر) من النيوكليوتيدات إلى تفاعل يولد إشارة ضوئية يتم تسجيلها بواسطة كاميرا CCD في الجهاز.
                      • تتناسب قوة الإشارة مع عدد النيوكليوتيدات المدمجة في تدفق النيوكليوتيدات الفردي.

                      يتتبع برنامج GS FLX System موقع الحمض النووي الذي يحمل الخرز على محور XY. كل حبة تتوافق مع إحداثيات XY في سلسلة من الصور. يتم تسجيل شدة الإشارة لكل تدفق نيوكليوتيد لكل حبة بمرور الوقت ويتم رسمها لتوليد مخطط تدفق. سينتج كل تسلسل مدته 10 ساعات يتم تشغيله على سلسلة GS FLX Titanium عادةً أكثر من مليون مخطط تدفق ، بمعدل تدفق واحد لكل قراءة.

                      تطوير وتأثير 454 التسلسل. http://www.ncbi.nlm.nih.gov/pubmed/18846085
                      روثبرج وآخرون التكنولوجيا الحيوية. المجلد 26 ، 1117-1124 9/10/2008

                      العمل المتضمن في تسلسل الجينوم الكامل:
                      • تتراكم قراءات التسلسل الفردي
                        • كل قراءة حوالي 500 نقطة أساس
                        • تستخدم الحوسبة لتجميع القراءات
                        • متواليات متجاورة تسمى contigs
                        • المستدمية النزلية
                          • 19687 قالبًا
                          • تم تجميع 24304 قراءة
                          • 11.631.485 نقطة أساس

                          يجب سد الثغرات في تسلسل الجينوم:

                          سد الفجوات

                          كونتيج عبارة عن مجموعة من قراءات الهلام التي ترتبط ببعضها البعض من خلال تداخل تسلسلها. يمكن تلخيص قراءات الهلام في contig لتشكيل تسلسل إجماع متجاور ، ويشكل طول هذا التسلسل طول contig.

                          • ارتفاع في عدد contig مع زيادة كمية القراءات
                          • سقوط ثابت حيث أن التسلسل المتراكم يسد الفجوات بين contigs
                          • مستويات قبالة كما قراءات جديدة أكثر احتمالا في كونتيج معروفة من فجوة
                          • ابدأ التشطيب
                          • لماذا الفجوات موجودة؟
                          • سد الفجوات
                            • فجوات التسلسل
                              • فجوات التسلسل - اختر الاستنساخ المناسب والمشي
                              • مكتبات بديلة (أي منها؟)
                              • PCR عبر الفجوة
                              • المناطق التي تكون فيها قراءات التسلسل أقل من 8-10
                              • متواليات متكررة -RNA

                              شرح الجينوم

                              • البحث عن ORFs
                                • ابحث عن ATG-Stop (+ بدائل)
                                • فوق حجم معين
                                • تتداخل
                                • تعتمد على الكمبيوتر ("Glimmer" & amp "Orpheus") ومدربة العين
                                • البحث في قواعد البيانات مع التسلسلات المترجمة المتوقعة- BLASTX
                                • ضع في اعتبارك مستوى التشابه والسياق
                                • مقارنات المجال
                                  • بفام / بروسايت

                                  Artemis: عارض التسلسل وأداة التعليق التوضيحي من مركز Sanger (http://www.sanger.ac.uk/Software/Artemis/)

                                  شودري ر ، بالين مج. xBASE ، مجموعة من قواعد البيانات عبر الإنترنت لعلم الجينوم المقارن البكتيري. الدقة الأحماض النووية. 2006 يناير 134 (إصدار قاعدة البيانات): D335-7.
                                  http://nar.oxfordjournals.org/cgi/content/full/34/suppl_1/D335

                                  نهج تسلسل الجينوم

                                  • علم الجينوم المقارن
                                    • مقارنة تنظيم الجينوم والمحتوى
                                    • حجم الجينوم
                                    • يكرر الجينوم / Tn / العاثيات
                                    • المحتوى الجيني
                                    • الحد الأدنى من محتوى الجينات
                                    • وظيفة الجينات - المعروف
                                    • توقع النمط الظاهري
                                    • وظيفة الجينات غير معروفة
                                    • وظيفة التحقيق

                                    البكتيريا: هل حجم الجينوم مهم؟

                                    • ربط حجم الجينوم بالقدرة على التكيف
                                      • القدرة على التخليق الحيوي
                                        • تخليق المغذيات
                                        • مقاومة الإهانات البيئية
                                        • الهياكل السطحية ، تكوين الأبواغ
                                        • الكشف عن التغيير أو المتطلبات والاستجابة بشكل مناسب
                                        • تنظيم النسخ

                                        على الرغم من أهمية حجم الجينوم البكتيري ، فإن كيفية التعبير عن الجينوم وتنظيمه في بيئته مهمة أيضًا:


                                        سياق الكروموسومات والتطور الوراثي لجينات conglutin في أراشيس على أساس التسلسل الجيني

                                        تحليل تسلسل الجينوم المقارن و [كدنا] آرا ح 2، أحد مسببات الحساسية الرئيسية للفول السوداني ، وما يرتبط به من مادة كيميائية آرا ح 6 تم أداؤها في Arachis hypogaea L. وأسلافها المفترضة ، أراشيس دورانينسيس و أراشيس إيبينسيس. أثبتت الهوية الكاملة بين التسلسلات التي ترميز الأشكال الإسوية لـ Ara h 2 أن هذه جينات متجانسة وتمثل تقويم العظام من أسلاف ثنائية الصبغيات. ثلاث نسخ من آرا ح 6 تم تحديدها في A. hypogaea، أحدهما يقع في الجينوم A والاثنان الآخران في جينوم B. أظهر تحليل التعبير مستويات أعلى من آرا ح 2 النصوص مقارنة بـ آرا ح 6. سمح التهجين الجيني في الموقع ذو العلامات المزدوجة بتحديد جينومين فرعيين ، يحتوي كل منهما على زوج واحد من آرا ح 2-آرا ح 6 الإشارات المترجمة عن طريق التألق في التهجين الموقع. أظهر توصيف المستنسخات الجينومية ارتباطًا وراثيًا وثيقًا بين Ara h 2.02 ونسخة واحدة من آرا ح 6 في الجينوم ب. قد يكون الارتباط المادي قد نشأ عن طريق الازدواج الترادفي والتباعد في جين الأسلاف. نتج عن حدث ازدواج الجينات الخاص بسلف الجينوم B آرا ح 6 Paralogs. توفر هذه البيانات دليلًا إضافيًا على العلاقات السلفية والتنظيم الجيني لعائلة الجينات conglutin في الجنس أراشيس ويمكن أن تسهم في تطوير الفول السوداني المضاد للحساسية.

                                        هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


                                        النتائج

                                        الاستنساخ ورسم الخرائط الوظيفية للمنطقة التنظيمية المنبع البشرية HNF-4 & # x003b1.

                                        أدى فحص مكتبة الجينوم البشري & # x003bbEMBL-4 مع جزء N-terminal من HNF-4 البشري & # x003b1 cDNA ، بما في ذلك 5 & # x02032 UTR والمجال A / B ، إلى أربعة نسخ إيجابية. كشف رسم خرائط إنزيم التقييد وتحليل اللطخة الجنوبية أن استنساخًا واحدًا يحتوي على جزء من exon الأول ومنطقة ما يقرب من 12.1 كيلو بايت من الجين البشري HNF-4 & # x003b1. أجرينا تخطيطًا واسعًا لإنزيم التقييد وحددنا تسلسل النيوكليوتيدات لعدة أجزاء من هذا الاستنساخ وقارننا البيانات مع تسلسل مسودة عمل الكروموسوم البشري 20 (رقم انضمام GenBank <"type": "entrez-nucleotide" ، "attrs": < "text": "NT_011382"، "term_id": "13653753"، "term_text": "NT_011382" >> NT_011382). كانت جميع التسلسلات المحددة بالإضافة إلى نمط إنزيم التقييد متطابقة مع التسلسل المودع ونمط الجين البشري HNF-4 & # x003b1 ، مما يؤكد أن الاستنساخ المعزول يمثل منطقة المنبع HNF-4 & # x003b1 غير المعاد ترتيبها.

                                        تم تحديد موقع بدء النسخ عن طريق اختبار التمديد التمهيدي باستخدام تمهيدي ذو علامة نهائية 26-nt ، والذي يقوم بتهجين 73 نقطة أساس في المصب من كودون ATG الأول. تم اكتشاف نطاق رئيسي واحد يبلغ 188 نقطة أساس في HepG2 poly (A) RNA ، والذي يضع موقع بدء النسخ 89 نقطة أساس في المنبع لكودون ATG الأول (11) (الشكل & # x200B (الشكل 1 أ) .1 أ). لتعيين المناطق التي تتفاعل مع بروتينات ربط الحمض النووي ، أجرينا تحليل موقع DNase I شديد الحساسية. باستخدام المسبار 1 ، تمكنا من اكتشاف موقعين رئيسيين شديد الحساسية لـ DNase I: أحدهما في منطقة المروج القريبة ، حوالي & # x02212300 bp من موقع بدء النسخ ، بينما كان الثاني يقع في المنطقة intronic بين exon 1b و exon 2 ، حوالي 1.6 كيلو بايت في اتجاه مجرى موقع بدء النسخ (الشكل & # x200B (الشكل 1 ب). 1 ب). باستخدام المسبار 2 ، اكتشفنا ثلاثة مواقع رئيسية شديدة الحساسية لـ DNase I في منطقة المنبع البعيدة ، حول & # x022126.6 ، & # x022128.0 ، و & # x022128.8 كيلو بايت من موقع بدء النسخ (الشكل & # x200B (الشكل 1 ب). 1 ب).

                                        رسم الخرائط الوظيفية لمنطقة المنبع البشرية HNF-4 & # x003b1. (أ) تحديد موقع بدء النسخ عن طريق تحليل تمديد التمهيدي باستخدام HepG2 poly (A) RNA. Arrow ، قليل النوكليوتيد المستخدم في النسخ العكسي وتفاعل تسلسل الحمض النووي. يتوافق كودون ATG المسطر مع موقع بدء الترجمة الأولية المقترح سابقًا (11). (ب) تحليل موقع DNase I شديد الحساسية. عولجت نوى HepG2 بـ 0 و 5 و 10 و 15 و 17 و 20 U من DNase I ، وتم تحضير الحمض النووي الجيني وهضمه باستخدام هينdIII (يسار) أو Kpnأنا (على حق). تم إجراء وضع العلامات غير المباشرة باستخدام المجسات المشار إليها. يُظهر التخطيطي مواضع المواقع الرئيسية شديدة الحساسية بالنسبة إلى موقع بدء النسخ (الأسهم الكبيرة). أسهم صغيرة ، ومواضع مواقع DNase I الصغيرة شديدة الحساسية الموجودة حول & # x022122.1 ، & # x022122.7 ، و & # x022125.6 كيلوبايت من موقع بدء النسخ. (ج) نشاط المروج لمنطقة المنبع البشرية HNF-4 & # x003b1 في خلايا HepG2. القضبان وأنشطة luciferase التي تم الحصول عليها باستخدام التركيبات المنقولة التي تحتوي على جين HNF-4 & # x003b1 البشري كامل الطول ، والمنطقة من kb & # x0221212.1 إلى bp & # x0002b67 من جين HNF-4 & # x003b1 ، ومشتقات HNF-4 & # x003b1 مع حذف أجزاء من المنطقة 5 & # x02032 (المشار إليها بواسطة موضع النوكليوتيدات 5 & # x02032) وتطبيعها مع أنشطة & # x003b2-galactosidase (التحكم الداخلي). تم حساب الأخطاء المعيارية من أربع تجارب مستقلة.

                                        لتحديد المنطقة التنظيمية الدنيا لـ HNF-4 & # x003b1 ، قمنا بدمج تسلسل المنبع 12.1 كيلو بايت لمراسل luciferase واستخدمت مشتقات حذف 5 & # x02032 لهذا الاستنساخ في فحوصات ترنسفكأيشن العابرة مع خط الخلايا HepG2 المشتق من ورم الكبد البشري. كما هو مبين في الشكل & # x200B الشكل 1C ، 1 C ، كان للطفرات التي تحتوي على عمليات حذف 5 & # x02032 تصل إلى kb & # x022120.56 تأثير ضئيل على نشاط المروج. نظرًا لأن عمليات الحذف الإضافية ألغت نشاط المروج ولأن جميع التركيبات كانت غير نشطة في خط خلايا هيلا غير الكبدية ، فقد خلصنا إلى أن منطقة المروج القريبة لجين HNF-4 & # x003b1 تحتوي على جميع العناصر المهمة المطلوبة لمستويات عالية من النسخ الكبدي في فحوصات تعداء عابرة .

                                        عوامل النسخ المرتبطة بمنطقة المروج القريبة.

                                        لتحديد مواقع ربط عامل النسخ داخل هذه المنطقة ، أجرينا تحليل بصمة DNase I في المختبر. تم اكتشاف خمس مناطق محمية رئيسية DNase I باستخدام المستخلصات النووية HepG2. تمتد البصمة 1 من bp & # x0221297 إلى & # x02212119 ، وتمتد البصمة 2 من bp & # x02212135 إلى & # x02212164 ، وتمتد البصمة 3 من bp & # x02212256 إلى & # x02212304 ، وتمتد آثار الأقدام 4 و 5 من bp & # x02212377 إلى & # x02212442 (الشكل & # x200B (الشكل 2A 2 A to C). كشف الفحص الدقيق لتسلسلات النيوكليوتيدات المقابلة للمناطق المحمية أن البصمة 1 والبصمة 4 والبصمة 5 تحتوي على مواقع ربط أساسية لـ HNF-1 & # x003b1 و - & # x003b2 و HNF-6 و GATA-6 ، على التوالي ، والتي تتطابق تسلسلها مع متواليات محفز الماوس (الشكل & # x200B (الشكل 2D). 2 D). ومن المثير للاهتمام أن المنطقة التي تتألف من nt & # x02212165 إلى & # x02212176 ، الذي يشبه موقع ربط HNF-3 ، غير محمي. مقارنة تسلسل الماوس ومنطقة المروج القريبة البشرية (nt & # x02212453 إلى & # x0002b1 رقم انضمام GenBank. <"النوع": "entrez-nucleotide" ، "attrs": <"text": "S77762" ، "term_id": "998414" ، "term_text": "S77762" >> S77762 و <"type": "entrez-nucleotide" ، " attrs ": <" text ":" NT_0113 82 "،" term_id ":" 13653753 "،" term_text ":" NT_011382 ">> NT_011382) بواسطة برنامج محاذاة التسلسل المتعدد Clustal W-1.5 كشفت عن هوية إجمالية قدرها 68 & # x00025 مع ستة فجوات ، بينما التسلسلات ضمن البصمة كانت المناطق 72 & # x00025 متطابقة (البيانات غير معروضة). كانت هوية التسلسل داخل أشكال الربط الأساسية الموضحة في الشكل & # x200B الشكل 2D 2 D 85 & # x00025. لا يتم حفظ البصمة 2 ، التي تحتوي على موقع ربط Sp-1 الكنسي ، في تسلسل محفز الماوس المقابل. تحتوي البصمة 3 على تكرار مباشر 1 (DR-1) ، وهو موقع ربط محتمل لمستقبلات الهرمون النووي. يختلف هذا التسلسل أيضًا في المنطقة المقابلة لمروج الماوس HNF-4 & # x003b1 (الشكل & # x200B (الشكل 2D). 2 د). تشير هذه الاختلافات إلى الاختلافات المحتملة الخاصة بالأنواع فيما يتعلق بمشاركة عبر- العوامل المؤثرة في تنظيم جين HNF-4 & # x003b1. لتأكيد هوية عوامل النسخ التي ترتبط بالمناطق الموضحة أعلاه ، أجرينا فحوصات الارتحال الفائق بوساطة الجسم المضاد.كانت الأجسام المضادة ضد HNF-1 و Sp-1 و HNF-6 و GATA-6 قادرة على استبدال أو إزالة المجمعات المكونة على FP-1 و FP-2 و FP-4 و FP-5 جزئيًا أليغنوكليوتيدات مزدوجة الشريطة ، على التوالي (الشكل & # x200 ب (الشكل 3 أ). 3 أ). تم استبدال المجمعات المتكونة على مسبار FP-3 بواسطة الأجسام المضادة COUP-TF و RXR & # x003b1 و HNF-4 & # x003b1 ، مما يشير إلى أن هذا العنصر هو من محتمل التربية على حقوق الإنسان. لاختبار الارتباط المحتمل لمستقبلات الهرمونات النووية المعروفة الأخرى مع هذا العنصر ، أجرينا فحوصات نقل الحركة الكهربية باستخدام المستخلصات الخلوية Cos-1 التي تعبر عن RXR & # x003b1-RAR & # x003b1 ، PPAR & # x003b1 ، VDR ، LXR & # x003b1 ، T3R & # x003b2 ، CPF / FTF و COUP-TFII و HNF-4 & # x003b1. لوحظ ارتباط قوي فقط بواسطة COUP-TFII. تم اكتشاف ارتباط أضعف ولكنه مهم بواسطة RXR & # x003b1-RAR & # x003b1 و HNF-4 & # x003b1 (الشكل & # x200B (الشكل 3 ب) 3 ب).

                                        تحديد مواقع ربط عامل النسخ في منطقة المروج القريبة لجين HNF-4 & # x003b1 البشري. تم إجراء تحليل بصمة DNase I في المختبر باستخدام 5 & # x02032-end-labels التي تحتوي على nt & # x0221245 to & # x02212450 (A) ، و nt & # x02212503 to & # x0002b67 (B) ، و nt & # x02212194 إلى & # x02212595 (C) مناطق المروج البشري HNF-4 & # x003b1 والكميات المشار إليها من المستخلصات النووية HepG2. Lanes G / A ، سلالم التسلسل الكيميائي Maxam-Gilbert لنفس المجسات. (د) عرض تخطيطي للمناطق ذات البصمة ومقارنة أشكالها التسلسلية مع المناطق المقابلة لمروج الماوس HNF-4 & # x003b1.

                                        تحديد عوامل النسخ الرئيسية المرتبطة بمنطقة المروج القريبة لجين HNF-4 & # x003b1 البشري. (أ) أجريت تجارب تحول الحركة الكهربي باستخدام المستخلصات النووية لكبد الفئران والمسمى أليغنوكليوتيد مزدوج الشريطة المطابق للمناطق المحددة البصمة. تم إجراء حضانات مع الأجسام المضادة وتفاعلات الارتباط على الجليد باستثناء الحضانات المسبقة باستخدام مضاد RXR & # x003b1 ومضاد HNF-4 & # x003b1 ، والذي تم إجراؤه في درجة حرارة الغرفة. (ب) تم إجراء تجارب تحول الحركة الكهربي مع مقتطفات من خلايا Cos-1 المنقولة وهمية (& # x02212) وخلايا Cos-1 المنقولة مع نواقل التعبير المشار إليها ومسبار FP-3 المسمى.

                                        التحليل الوظيفي لمنطقة المروج القريبة.

                                        للتأكد من الأهمية الوظيفية لما ورد أعلاه رابطة الدول المستقلة العناصر و عبر- عوامل التأثير ، أدخلنا طفرات في مناطق البصمة الفردية التي تلغي ارتباط عوامل النسخ المقابلة. كشفت فحوصات ترنسفكأيشن العابرة مع خلايا HepG2 أن الطفرات في مواقع الربط HNF-1 (البصمة 1) و Sp-1 (البصمة 2) و HNF-6 (البصمة 4) قللت من نشاط المروج إلى 17 و 70 و 10 & # x00025 ، على التوالي ، لقيمة من النوع البري (الشكل & # x200B (الشكل 4) .4). في المقابل ، أدت الطفرة في منطقة HRE (البصمة 3) إلى زيادة مضاعفة تقريبًا في نشاط المروج ، بينما كان للطفرات في موقع GATA-6 (البصمة 5) تأثير هامشي عليها فقط. الإفراط في التعبير عن HNF-1 & # x003b1 أو HNF-6 أو GATA-6 يحفز النسخ من المروج من النوع البري 2.9 أضعاف و 2.6 أضعاف و 2.4 ضعفًا ، على التوالي (الشكل & # x200B (الشكل 4). 4). في المقابل ، أدى الإفراط في التعبير عن COUP-TFII إلى تثبيط نشاط المروج إلى حوالي 38 & # x00025 من مستويات النوع البري. لم يؤثر أي من العوامل على نشاط التركيبات الطافرة المقابلة (الشكل & # x200B (الشكل 4) .4). تشير هذه البيانات إلى أن HNF-1 & # x003b1 و Sp-1 و HNF-6 قد تعمل كمنظمات إيجابية أساسية للنسخ عالي المستوى لجين HNF-4 & # x003b1 البشري في خلايا HepG2 ، بينما COUP-TFII ، من خلال الربط للتربية على حقوق الإنسان ، ينظمها بشكل سلبي. على الرغم من أن GATA-6 كان قادرًا على التعامل مع المروج ، إلا أن وظيفته ، على الأقل في خلايا HepG2 ، تبدو زائدة عن الحاجة ، لأن تعطيل موقع الربط الخاص به لم يغير نشاط المروج. نظرًا لأن خلايا HepG2 تحتوي ، داخليًا ، على مستويات عالية من عوامل النسخ المذكورة أعلاه ، يصعب تقييم الدرجات النسبية للمعاملات والتأثيرات التآزرية المحتملة بين أزواج عوامل النسخ باستخدام خط الخلية هذا. للتغلب على هذه المشكلة ، أجرينا تجارب نقل العدوى مع خلايا هيلا ، والتي لا تعبر عن HNFs الذاتية. لوحظت معاملات قوية من خلال الإفراط في التعبير عن HNF-1 & # x003b1 و HNF-6 و GATA-6 (73 ضعفًا و 70 ضعفًا و 62 ضعفًا ، على التوالي) (الشكل & # x200B (الشكل 5A). 5 أ). كانت المعاملات المعتمدة على HNF-1 & # x003b2- و HNF-3 & # x003b1- و HNF-4 & # x003b1 أقل وضوحًا (4 أضعاف و 6 أضعاف و 19 ضعفًا ، على التوالي) ، بينما COUP-TFII overexpression ، مثل من المتوقع ، لم يتم تنشيط المروج (الشكل. & # x200B (الشكل 5 أ). 5 أ). كما هو واضح حتى هذه النقطة ، هناك عوامل متعددة لديها القدرة على تنشيط مروج HNF-4 & # x003b1. أثار هذا السؤال عما إذا كان ، كما هو الحال في معظم المناطق التنظيمية المعقدة الأخرى ، قد يكون الإجراء المتزامن لأكثر من عامل مطلوبًا للنسخ عالي المستوى لجين HNF-4 & # x003b1. تم اختبار ذلك من خلال تحليل التآزر المحتمل للعوامل المذكورة أعلاه على المروج. كما هو مبين في الشكل. & # x200B الشكل 5 ب ، 5 ب ، نتج عن تعايش HNF-1 & # x003b2 و GATA-6 معاملة أعلى بكثير من مجموع عمليات التنشيط التي تم الحصول عليها بواسطة العوامل الفردية (390 ضعفًا مقابل 4 أضعاف زائد 62 ضعفًا). لم يؤد تعايش العوامل الأخرى مع HNF-1 & # x003b2 إلى تأثيرات تآزرية قوية. ومن المثير للاهتمام ، أن الإفراط في التعبير عن HNF-4 & # x003b1 أدى إلى تقليل التآزر HNF-1 & # x003b2 & # x02013GATA-6 ، وكما هو متوقع ، فإن الإفراط في التعبير عن النسخ الملغى لـ COUP-TFII (الشكل 5 ب). ب). ومع ذلك ، لم تظهر HNF-1 & # x003b1 أي تآزر مع GATA-6 ، لكنها فعلت ذلك مع HNF-6 أو HNF-4 & # x003b1 (475 ضعفًا مقابل 73 ضعفًا بالإضافة إلى 70 ضعفًا و 417 ضعفًا مقابل 73 - أضعاف زائد 19 أضعاف ، على التوالي) (الشكل. & # x200B (الشكل 5C). 5 ج). لم يؤد الإفراط في التعبير عن العوامل الثلاثة إلى مزيد من التحسين ، بينما أدى الإفراط في التعبير عن COUP-TFII إلى تثبيط النسخ (الشكل & # x200 ب (الشكل 5 ج). 5 ج). تشير هذه النتائج إلى إمكانية توليفات عامل النسخ البديلة في تكوين مركب بدء النسخ النشط على محفز HNF-4 & # x003b1 البشري.

                                        التحليل الوظيفي ل رابطة الدول المستقلة عناصر المروج البشري HNF-4 & # x003b1. تم نقل خلايا HepG2 بشكل عابر مع المنطقة التي تتكون من nt & # x02212560 إلى & # x0002b67 وتحتوي على بنية luciferase (wt) ومشتقاتها التي تحمل طفرات داخلية في المناطق المشار إليها (mFP1 و mFP3 و mFP5 و mFP4 و mFP2). عند الإشارة ، تم نقل الخلايا باستخدام 500 نانوغرام من نواقل التعبير المقابلة. القضبان والقيم المتوسطة والأخطاء القياسية لأنشطة luciferase الطبيعية من أربع تجارب مستقلة على الأقل معبراً عنها كمضاعفات النشاط الذي تم الحصول عليه باستخدام المروج من النوع البري.

                                        تحليل التآزر بين عوامل النسخ على مروج HNF-4 & # x003b1 البشري. (أ) تم نقل خلايا هيلا مع 2 & # x003bcg من الحمض النووي من المنطقة التي تضم nt & # x02212560 إلى & # x0002b67 وتحتوي على مراسل luciferase و 250 نانوغرام من نواقل التعبير المشار إليها. (B و C) تم نقل الخلايا باستخدام متجهات التعبير المشار إليها مع 250 نانوغرام من HNF - & # x003b2 أو متجه التعبير HNF-1 & # x003b1 (& # x0002b) ، على التوالي. القضبان والقيم المتوسطة والأخطاء القياسية لأنشطة luciferase الطبيعية من أربع جولات مستقلة على الأقل من التجارب التي أجريت في نسختين مع جميع العينات ويتم التعبير عنها كمضاعفات النشاط الذي تم الحصول عليه في عمليات التحويل باستخدام المروج-المراسل وحده (& # x02212). لاحظ المقياس المختلف للإحداثيات في اللوحة A.

                                        تجنيد عوامل النسخ على مروج HNF-4 & # x003b1 في خلايا HepG2.

                                        للتحقق من أهمية البيانات التي تم الحصول عليها عن طريق فحوصات ترنسفكأيشن العابرة في سياق الكروماتين في الخلايا السليمة ، أجرينا تجارب الترسيب المناعي للكروماتين باستخدام خط خلايا الورم الكبدي البشري HepG2 ، والذي يعبر عن HNF-4 & # x003b1 عند مستويات عالية. يمكن للأجسام المضادة التي يتم رفعها ضد HNF-1 & # x003b1 و HNF-6 و COUP-TFII و Sp-1 أن ترسب بشكل فعال وعلى وجه التحديد الحمض النووي لمروج HNF-4 & # x003b1 ، مما يشير إلى ارتباط مستقر في الجسم الحي لهذه العوامل مع المروج (الشكل & # x200B (الشكل 6) .6). من ناحية أخرى ، فشلنا في الكشف عن إشغال المروج بواسطة HNF-1 & # x003b2 أو HNF-4 & # x003b1 أو HNF-3 & # x003b1 أو GATA-6 ، على الرغم من حقيقة أنه بخلاف HNF-1 & # x003b2 ، يتم التعبير عن هذه العوامل بكثرة في خلايا HepG2 (البيانات غير معروضة). لذلك ، على الأقل في خلايا HepG2 ، يبدو أن نسخ HNF-4 & # x003b1 يتم تنظيمه من خلال العمل المشترك لـ HNF-1 & # x003b1 و HNF-6 و Sp-1 ويتم ضبطه بدقة من خلال الوجود المتزامن لـ COUP-TFII ، الذي يعمل كمغير سلبي.

                                        توظيف عامل النسخ لمروج HNF-4 & # x003b1 البشري في سياق الكروماتين في الخلايا السليمة. تم تحضير الكروماتين القابل للذوبان من خلايا HepG2 المثبتة بالفورمالديهايد وترسيبه المناعي (IP) مع الأجسام المضادة للبروتينات المشار إليها. تم تضخيم الحمض النووي في الراسبات المناعية باستخدام بادئات تشمل مروج HNF-4 & # x003b1 القريب (مروج hHNF-4) أو 3 & # x02032 UTR من جين HNF-4 & # x003b1 البشري. يتم عرض صورة التصوير الشعاعي التلقائي للمنتجات المفصولة على هلام بولي أكريلاميد 5 & # x00025.

                                        يؤثر مسار إشارات حمض الريتينويك بشكل إيجابي على تعبير HNF-4 & # x003b1 البشري.

                                        كما هو موضح أعلاه ، يمكن أيضًا ربط تسلسل HRE للبصمة 3 بـ RXR & # x003b1-RAR & # x003b1 heterodimers. لاختبار الأهمية الوظيفية لهذا التفاعل ، سألنا عما إذا كان الإفراط في التعبير عن RXR & # x003b1-RAR & # x003b1 يؤثر على نشاط مروج HNF-4 البشري & # x003b1 في خلايا HepG2. كما هو مبين في الشكل. & # x200B الشكل 7A ، 7 A ، RXR & # x003b1-RAR & # x003b1 يمكن أن تحفز نشاط كل من الطول الكامل والداني (بدءًا من 12.1 كيلو بايت و 560 نقطة أساس ، على التوالي ، بداية بداية النسخ الموقع) -الراسلون المحتويون على المروج بطريقة تعتمد على الترابط. لوحظ تحريض مماثل مع بناء محفز خيمري يحتوي على ست نسخ من تسلسل HNF-4 & # x003b1 HRE أمام مروج الحد الأدنى من AdML. عداء COUP-TFII هذا التنشيط في جميع الحالات (الشكل & # x200B (الشكل 7 أ). 7 أ). عندما تم تحور موقع HRE ، لم يلاحظ أي تنشيط بوساطة حمض الريتينويك. يمكن أن يتضمن الأساس الجزيئي للخصم COUP-TFII & # x02013RXR & # x003b1-RAR & # x003b1 منافسة بين هذه العوامل لـ HNF-4 & # x003b1 HRE. لاختبار ذلك ، قمنا بالتحقيق في الإشغال في الجسم الحي لمروج HNF-4 البشري بواسطة هذه العوامل في خلايا HepG2 غير المعالجة والمعالجة بحمض الريتينويك. كان الإشغال التفاضلي للمروج بواسطة COUP-TFII و RXR & # x003b1 أو RAR & # x003b1 في غالبية الخلايا واضحًا لأن الإشارة المكتشفة في الرواسب المناعية للكروماتين COUP-TFII انخفضت بعد ساعتين من العلاج بحمض الريتينويك ، مع زيادة مصاحبة في إشارة إما RXR & # x003b1 أو RAR & # x003b1 المناعية (الشكل & # x200B (الشكل 7 ب). 7 ب). تشير النتائج المذكورة أعلاه إلى أن HNF-4 & # x003b1 HRE هو عنصر استجابة حقيقي لحمض الريتينويك وأن تعبير HNF-4 & # x003b1 قد يزيد في ظل ظروف فسيولوجية معينة. للتحقق من هذا الاحتمال في الجسم الحي ، عالجنا خلايا HepG2 بـ 9-رابطة الدول المستقلة- حمض الريتينويك وراقب مستويات التعبير عن HNF-4 & # x003b1 عن طريق تحليل RT-PCR شبه الكمي وتحليل اللطخة الغربية. لوحظ زيادة 2.5 ضعف في مستويات HNF-4 & # x003b1 mRNA المستقرة ، حيث بلغ المستوى ذروته حوالي ساعتين بعد العلاج ثم انخفض تدريجياً لمدة 6 ساعات التالية (الشكل & # x200B (الشكل 7C 7 C و E) ومن المثير للاهتمام أن مستويات البروتين الخلوي HNF-4 & # x003b1 استمرت في الزيادة لمدة تصل إلى 8 ساعات (الشكل & # x200B (الشكل 7D 7 D و E) ، مما يشير إلى أنه بالإضافة إلى مشاركتها في تقوية النسخ ، 9-رابطة الدول المستقلةقد يعمل حمض الريتينويك أيضًا في خطوة لاحقة ، مما قد يؤثر على استقرار البروتين HNF-4 & # x003b1.

                                        التنشيط المعتمد على Ligand للجين البشري HNF-4 & # x003b1 بواسطة RXR & # x003b1-RAR & # x003b1 في خلايا HepG2. (أ) نمت خلايا HepG2 في 10 & # x00025 مصل العجل الجنيني المغلف بالفحم ديكستران الذي يحتوي على DMEM والمعدية بشكل عابر مع 2 & # x003bcg من المراسلين المشار إليهم و 500 نانوغرام من نواقل التعبير المشار إليها. بعد تعداء الخلايا عولجت بـ 1 & # x003bcM 9-رابطة الدول المستقلة- حمض الريتينويك أو تركه دون معالجة لمدة 36 ساعة حتى الحصاد. القضبان ، القيم المتوسطة والأخطاء المعيارية لأنشطة luciferase الطبيعية من أربع تجارب مستقلة على الأقل. (ب) خلايا HepG2 ، التي نمت في مصل مجرد يحتوي على DMEM ، تُركت دون علاج أو عولجت بـ 1 & # x003bcM 9-رابطة الدول المستقلة- حمض الريتينويك لمدة 2 ساعة. تم تحضير الكروماتين القابل للذوبان من خلايا HepG2 المثبتة بالفورمالديهايد وترسيبه المناعي (IP) مع الأجسام المضادة للبروتينات المشار إليها. تم تضخيم الحمض النووي في الراسبات المناعية باستخدام بادئات تشمل مروج HNF-4 & # x003b1 القريب (مروج hHNF-4). يتم عرض صورة التصوير الشعاعي التلقائي للمنتجات المفصولة على هلام بولي أكريلاميد 5 & # x00025. (C و D) خلايا HepG2 ، التي نمت في مصل مجرد يحتوي على DMEM ، عولجت بـ 1 & # x003bcM 9-رابطة الدول المستقلة- حمض الريتينويك للفترات المحددة. تم تحضير مجموع الحمض النووي الريبي والمستخلصات النووية ، وتم تحليل التعبير عن HNF-4 & # x003b1 بواسطة RT-PCR باستخدام بروتين فوسفوري الريبوزومي الحمضي البشري كعنصر تحكم (C) أو عن طريق النشاف الغربي باستخدام جسم مضاد أولي ضد HNF-4 & # x003b1 أو الجسم المضاد Sp-1 كعنصر تحكم داخلي (D). (E) النسبي HNF-4 & # x003b1 mRNA ومستويات البروتين مقابل الوقت بعد 9-رابطة الدول المستقلةتم رسم إضافة حمض الريتينويك.


                                        النتائج

                                        تحديد بروتين 30 كيلو دالتون المتورط في مقاومة المصل.

                                        خلال الدراسات التي تميز H. دوكري التفاعل مع الكريات البيض متعددة الأشكال ، تم إجراء سلسلة من البقع الغربية باستخدام أجسام مضادة مختلفة لبروتينات أوبا من المكورات البنية. المصل المضاد متعدد النسيلة لـ OpaF لسلالة المكورات البنية FA1090 تفاعل مع بروتين يتراوح بين 28 و 35 كيلو دالتون في لوحة من السلالات (البيانات غير معروضة) ، والتي حددناها لاحقًا DsrA. سلالة واحدة ، CIP A75 ، لم تتفاعل. كان CIP A75 مثيرًا للاهتمام لأنه سبق أن ثبت أنه عديم الفوعة في نموذج الأرانب للعدوى ، ولأنه عرضة للمصل ، ولإظهار التقيد المنخفض بخلايا HEp-2 ، وللتعبير عن LOS مقطوع (31 ، 47).

                                        للتأكد من أن التفاعل التبادلي السابق الذي شوهد مع المصل المضاد لـ OpaF كان بسبب وجود DsrA وللتأكد من النسبة المئوية للسلالات المعبر عنها DSRA، تم إنشاء مصل محدد لـ DsrA باستخدام DsrA المنقى من SDS-PAGE من H. دوكري سلالة 35000 كمناعة. تم اختبار ما مجموعه 29 عزلة مخبرية وسريرية متنوعة جغرافيًا لوجود DsrA بواسطة النشاف الغربي باستخدام مصل مضاد لـ DsrA ، وتفاعل 26 من 29 سلالة ، على الرغم من اختلاف الكتلة الجزيئية الظاهرية للبروتين التفاعلي (الشكل & # x200 ب) (الشكل 1 أ 1 أ والبيانات غير معروضة) يبدو أن البروتينات التي تم التعرف عليها في لطخة DsrA الغربية وصمة OpaF الغربية هي نفس البروتينات بناءً على حركتها النسبية ووجودها أو غيابها في كل سلالة (البيانات غير معروضة).

                                        توزيع بروتين DsrA ومقاومة مصل الدم المختار H. دوكري سلالات. (أ) مجموع البروتينات الخلوية من H. دوكري تعرضت السلالات لـ SDS-PAGE والنشاف الغربي باستخدام الأمصال المضادة لـ DsrA. تم اكتشاف الجسم المضاد المرتبط مع الجسم المضاد الثانوي المترافق مع الفوسفاتيز القلوي والركيزة BCIP / NBT. 20 إضافية متنوعة جغرافيا H. دوكري أعربت السلالات أيضًا عن بروتين من 28 إلى 35 كيلو دالتون والذي تفاعل مع هذا المصل (البيانات غير معروضة). يشار إلى أسماء السلالات فوق كل حارة. تظهر على يسار الهلام معايير الكتلة الجزيئية. (ب) قتل جراثيم مختارة H. دوكري سلالات في 50 & # x00025 NHS. H. دوكري مع & # x00394NHS أو fNHS لمدة 45 دقيقة ، وتم تحديد التهم القابلة للتطبيق. النسبة المئوية للبقاء على قيد الحياة في fNHS مقارنة بـ & # x00394NHS (المعينة 100 & # x00025) تظهر على ذ محور. يتم تجميع البيانات من تجارب منفصلة أجريت في ثلاثة أيام مختلفة على الأقل.

                                        تم اختيار تسع سلالات للدراسة بمزيد من التفصيل: ثلاث سلالات لم تعبر عن DsrA أو تم التعبير عنها بشكل ضعيف وستة سلالات تعبر بقوة عن DsrA (الشكل & # x200B (الشكل 1 أ). 1 أ). تم الإبلاغ سابقًا عن السلالات الثلاث غير التفاعلية أو ضعيفة التفاعل الموضحة في الشكل. & # x200B الشكل 1A ، 1 A ، CIP A75 ، CIP A77 (30 & # x0201332) ، و CIP 542 (CAN) (4) ، على أنها سلالات عديمة الفوعة. سلالات معبرة عن DsrA (الشكل & # x200B (الشكل 1 1 الجدول & # x200B الجدول 1) 1) المعروف أنها خبيثة تشمل (1) سلالة التحدي البشري المدروسة على نطاق واسع 35000 (2) CIP 542 (CDC) ، والتي سبق عرضها لـ تسبب عدوى مكتسبة من المختبر البشري (49) و (3) V-1157 ، وهي سلالة خبيثة في النموذج المعتمد على درجة حرارة الأرانب H. دوكري العدوى (I. LeDuc ، C. Elkins ، و W. Cameron ، بيانات غير منشورة).

                                        وقد وثقت دراسات سابقة تلك الضراوة H. دوكري سلالات مقاومة المصل (30). أجرينا دراسات حساسية المصل مع التسعة المختارين H. دوكري سلالات (الشكل & # x200B (الشكل 1 ب). 1 ب). السلالات الثلاثة التي لم تعبر أو لم يتم التعبير عنها بشكل ضعيف DSRA & # x0005bCIP A75 و CIP A77 و CIP 542 (CAN) & # x0005d كانت أكثر عرضة للمصل (5 ، 7 ، و 0 & # x00025 البقاء على قيد الحياة مع 50 & # x00025 NHS ، على التوالي) من تلك التي تم التعبير عنها DSRA. من السلالات الست التي أعربت DSRA، خمسة منهم كان لديهم أكثر من 50 & # x00025 ناجٍ (المدى ، من 65 إلى 155 & # x00025) عند الحضانة في 50 & # x00025 NHS. واحد DSRA- سلالة التعبير (CHIA) لديها حساسية متوسطة في المصل (بقاء 18 & # x00025) ولم تنمو بشكل جيد على أي وسط تم اختباره (البيانات غير معروضة). وهكذا ، في هذه الدراسات الأولية ، كان هناك ارتباط بين مستويات DSRA التعبير ، الفوعة ، ومقاومة المصل ، وقد وفر هذا الارتباط الزخم لمزيد من الدراسات.

                                        الدراسات الجزيئية.

                                        من خلال سلسلة من التجارب التي تتضمن النشاف الغربي ، والترسيب المناعي ، وأخيراً تسلسل الأحماض الأمينية N-terminal ، قررنا أن بروتين DsrA لم يكن هو نفسه البروتين الدهني Hlp 28-kDa الموصوف سابقًا (المرجع 22 والبيانات غير معروضة). تم العثور على تسلسل الحمض الأميني N-terminal لبروتين 30-kDa DsrA المناعي للسلالة 35000 ليكون QQPPKFAGVS SLYSYEYDYG KGKKTKSNEG. لم يتم الكشف عن تماثلات مهمة في البداية عندما تم البحث عن تسلسل الببتيد هذا ضد GenBank ، بما في ذلك بروتينات أوبا المكورات البنية.

                                        تم تصنيع اثنين من النكليوتيدات المتحللة (أليغنوكليوتيدات 6 و 7 & # x0005bTable 2 & # x0005d) بناءً على تسلسل N- الطرفية أعلاه ووجد أنهما يتهجين على وجه التحديد إلى 1.1 كيلو بايت. سابقة بمعنى البيئةالفرقة الكروموسومية RI من H. دوكري سلالة 35000 (الشكل & # x200B (الشكل 2 2 والبيانات غير معروضة) لم تنجح محاولات استنساخ هذا الجزء.للحصول على التسلسل ، تم استخدام ثلاثة VA PCRs منفصلة (انظر المواد والطرق للحصول على التفاصيل) لتضخيم ذات الصلة الموقع والمناطق المحيطة (الشكل & # x200B (الشكل 2). 2) أكدت تفاعل البوليميراز المتسلسل الداخلي الإضافي والتسلسل المباشر لمنتجات VA PCR من هذه التفاعلات الثلاثة بعضها البعض (الشكل & # x200 ب (الشكل 2 2 ، انظر المواد) والطرق) أظهر تحليل هذا التسلسل منتجًا جينيًا مشابهًا لبروتين UspA2 الموراكسيلا النزلية (1) وبروتين يادا من يرسينيا النيابة. (39). كلا هذين البروتينين له دور في تحديد سمات الضراوة المهمة (بما في ذلك مقاومة المصل).

                                        تسلسل الحمض النووي واستنتاج تسلسل الأحماض الأمينية لـ H. ducreyi dsrA موضع من سلالة 35000.

                                        تسلسل الحمض النووي لـ DSRA موضع ، بما في ذلك 100 نقطة أساس من التسلسل المنبع لبداية ATG و 126 نقطة أساس من التسلسل في اتجاه المصب لكودون إنهاء TAA ، في الشكل 3 & # x200B. 3. تم الحصول على التسلسل من منتجات PCR التي تم تضخيمها باستخدام الاشعال 14 و 24 ، والتي يتم اشتقاق تسلسلها من DNA خارج DSRA ORF (الشكل & # x200B (الشكل 2). 2). عناصر المروج المفترضة المشابهة لـ & # x0221235 (TGATAA) و & # x0221210 (TATATT) بكتريا قولونية تم تحديد تسلسل الإجماع بدءًا من النيوكليوتيدات (nt) 13 (TTGACA) و nt 35 (TAGAAT) ، على التوالي ، وتم فصلها بمقدار 16 nt. تم العثور على موقع ربط الريبوسوم المفترض (TAATGAGG) بداية من 13 nt من المنبع من DSRA ابدأ الكودون. بدءًا من nt 913 وانتهى عند nt 946 ، كانت حلقة دبوس شعر مقلوبة تحتوي على 13 نيوكليوتيدًا متطابقًا ، بما يتوافق مع فاصل النسخ. يقع الجين مباشرة في اتجاه مجرى النهر DSRA ولكن في الاتجاه المعاكس كان ORF مع التماثل مع البروتين الافتراضي HI0107 من تسلسل الجينوم المستدمية النزلية. كان محتوى G & # x0002bC من 1 كيلو بايت من تسلسل الحمض النووي المقدم 34.5 & # x00025 ، بما يتوافق مع الطبيعة الغنية بـ AT لـ المستدمية الحمض النووي.

                                        ال DSRA توقع ORF بروتين 28215 Da ، والذي ، عند معالجته ، سينتج عنه بروتين ناضج قدره 26375 Da ، بالاتفاق مع الترحيل في SDS-PAGE للسلالة 35000 (الشكل & # x200B (الشكل 1) .1). تم تأكيد موقع انشقاق إشارة الببتيداز I غير المعتاد لـ TMA (AXA نموذجي) من خلال تدهور Edman لـ DsrA. كشف تدهور Edman عن الهوية في 28 من 30 حمض أميني مقارنة بتسلسل الأحماض الأمينية المستنبطة لـ DsrA. كانت البقايا الأولى والثانية من البروتين الناضج ، QQ ، غير عادية في شحنتها ، لكن إصدارات معينة من YadA تبدأ أيضًا بحموضين أمينيين مشحونين (انظر أدناه) (37 ، 39). تمشيا مع توطين الغشاء الخارجي ، احتوت DsrA على نموذج طرفي كربوكسيل ينتهي بفينيل ألانين ، والذي يوجد في غالبية بروتينات الغشاء الخارجي المتكاملة (41 ، 46). تم توقع أن يكون بروتين DsrA الناضج أساسيًا للغاية ، مع pI من 9.1 ، وهو ما يمثل ضعف نقله أثناء النشاف الغربي (البيانات غير معروضة).

                                        يظهر محاذاة بروتين DsrA مع بروتينات مماثلة في الشكل. & # x200B الشكل 4. 4. كان DsrA أكثر تشابهًا مع UspA2 و YadA في منطقة الطرف C وكان أكثر تباينًا في الطرف N. أظهر برنامج Bestfit أن DsrA كانت 45 & # x00025 مماثلة و 40 & # x00025 متطابقة مع UspA2 و 47 & # x00025 مماثلة و 39 & # x00025 مماثلة لـ YadA. وتجدر الإشارة إلى أن كلا هذين البروتينين غير المتجانسين أكبر بكثير من DsrA ، مما قد يفسر اختلافاتهما في المجالات N-terminal. يُعتقد أن الطرف C لـ YadA مثبت في الغشاء الخارجي ، ويُعتقد أن الطرف N يحتوي على المناطق الوظيفية لبروتين YadA (34 ، 35 ، 43).

                                        مقارنة تسلسل الأحماض الأمينية لـ DsrA مع البروتينات ذات الصلة. تسلسل الأحماض الأمينية للنطاقات الطرفية C لبروتين DsrA لـ H. دوكري، وهو بروتين UspA2 من M. النزلة، وبروتين YadA من Y. enterocolitica تم مقارنتها. تشير المخلفات المظللة المظللة إلى بقايا متطابقة أو محفوظة.

                                        بناء وتوصيف أ H. ducreyi dsrA متحولة.

                                        تم إنشاء متحولة متساوية المنشأ (FX517 Table & # x200B Table1) 1) عن طريق الاستبدال الأليلي للنوع البري DSRA موضع السلالة 35000. محاولات أولية للحصول على تقاطع مزدوج باستخدام كاسيت CAT في الملف المستنسخ DSRA لم ينجح الجين عند استخدام pUNCH 1255 (البيانات غير معروضة). لذلك ، استخدمنا طريقة من مرحلتين تم وصفها مؤخرًا للحصول على المسوخ (7) (انظر المواد والطرق). باستخدام هذا الإجراء ، تم الحصول على العديد من النواتج المشتركة المقاومة للكلورامفينيكول. بعد أن تم تسليط كل تكامل مشترك على أطباق شوكولاتة X-Gal ، تم الحصول على العديد من المسوخ لكل تكامل مشترك ، ولم يتم التعبير عن أي منها DSRA (البيانات غير ظاهرة). تم اختيار متحولة واحدة ، FX517 ، لمزيد من الدراسة. تم تحضير الأغشية الخارجية من السلالة الأم والمتحولة FX517 وتعرضت لتلطيخ SDS-PAGE و Coomassie أو SDS-PAGE والنشاف الغربي (الشكل & # x200B (الشكل 5A 5 A و B ، على التوالي). كان بروتين الغشاء في السلالة 35000 غائبًا في الطفرة.لم يتم الحصول على أي تفاعل من FX517 عند استخدام مضاد DsrA المضاد (الشكل & # x200B (الشكل 5 ب) 5 ب) أو مضاد OpaF (البيانات غير معروضة).

                                        SDS-PAGE والنشاف الغربي للسلالة الأم 35000 و DSRA متحولة FX517. (أ) تم تحضير الأغشية الخارجية ، وذوبانها عند 37 أو 100 & # x000b0C ، وتعريضها لتلطيخ SDS-PAGE و Coomassie الأزرق. (ب) بالنسبة للبقعة الغربية ، تم إذابة الأغشية الخارجية عند 100 & # x000b0 درجة مئوية ، وتم نقلها إلى النيتروسليلوز ، وتم فحصها باستخدام مصل الماوس المضاد لـ DsrA. تم اكتشاف الجسم المضاد المرتبط مع الجسم المضاد الثانوي المترافق مع الفوسفاتيز القلوي والركيزة BCIP / NBT. تشير العلامات النجمية إلى مواقع بروتين DsrA. الأمراض المنقولة بالاتصال الجنسي ، معايير الوزن الجزيئي.

                                        كان DsrA ، مثل UspA2 و YadA ، يميل إلى تكوين مجمعات أو multimers مفترضة ، خاصة عند الذوبان عند درجة حرارة منخفضة تبلغ 37 & # x000b0C (الشكل & # x200B (الشكل 1A 1 A و & # x200B و 5 A والبيانات لا يهاجر النموذج الرئيسي متعدد القراءات بالقرب من معيار الألبومين في مصل الأبقار (66 كيلو دالتون) وقد يمثل نموذجًا متماثلًا ، نظرًا لأن التلوين الكهربائي والغليان لهذا النموذج يحولان في الغالب إلى شكل المونومر في المواد الهلامية SDS-PAGE (البيانات غير معروضة). لا تخصص آخر H. دوكري لوحظ بروتين الغشاء الخارجي بعد غليان العينات المخففة كهربائيًا ، لكن لا يمكننا استبعاد وجود بروتينات ثانوية أخرى كجزء من هذا المركب.

                                        هيكل المطفرة DSRA تم تأكيد locus في FX517 بواسطة PCR و Southern blotting. PCR من DSRA نتج عن الموضع في السلالات 35000 و FX517 مع الاشعال 9 و 12 ، والتي تحيط بإدخال CAT (الشكل & # x200B (الشكل 2) ، 2) ، منتجات PCR تبلغ 500 و 1500 نقطة أساس ، على التوالي. يُفترض أن الفرق في الحجم بمقدار 1000 نقطة أساس يرجع إلى شريط CAT الموجود في FX517 (البيانات غير معروضة).

                                        تم هضم الحمض النووي الكروموسومي من الوالد و FX517 باستخدام هينCII ، BglII أو سابقة بمعنى البيئةRI وسبرنا في اللطخات الجنوبية باستخدام DSRA و CAT تحقيقات. حيث هينلا يقيد cII DSRA أو CAT ، الفرقة التي يتعرف عليها DSRA زاد حجم المسبار بشكل طفيف في المتحولة مقارنة بالوالد. الأحجام الدقيقة لهذه هينلا يمكن تحديد شظايا cII لأنها كانت في منطقة من الهلام تم حلها بشكل سيئ. في لطخة متطابقة ، تعرف مسبار CAT على الأكبر فقط هيننطاق cII للطفرة (البيانات غير معروضة). كما هو متوقع ، فإن Bglالثاني و سابقة بمعنى البيئةقدمت عمليات الهضم RI مواقع جديدة في متحولة DSRA الجين ، مما أدى إلى نطاقات تهجين ذات حجم مناسب (البيانات غير معروضة). مجتمعة ، هذه البيانات متوافقة مع حدث الاستبدال الأليلي.

                                        النمط الظاهري لمقاومة المصل من DSRA متحولة.

                                        حساسية المصل التي تحدث بشكل طبيعي DSRA دفعتنا المسوخات ودور بروتينات YadA و UspA2 ذات الصلة في التوسط في مقاومة المصل إلى اختبار FX517 لحساسية المصل. دراسات لقتل المصل لسلالة الوالدين 35000 و DSRA تم إجراء متحولة FX517 باستخدام 25 و 50 & # x00025 NHS المجمعة (الشكل & # x200B (الشكل 6) .6). كان FX517 شديد الحساسية لـ NHS وأظهر بقاء 0 و 2 & # x00025 في 50 و 25 & # x00025 NHS ، على التوالي. في المقابل ، كانت السلالة الأم 35000 مقاومة نسبيًا للمصل ، حيث أظهرت بقاء 79 و 50 & # x00025 في 50 و 25 & # x00025 NHS (ص = 0.002 و 0.004 لـ 50 و 25 & # x00025 NHS ، على التوالي ، باستخدام إقران الطالب ر اختبار). وهكذا ، كان DsrA ضروريًا للتعبير عن النمط الظاهري المقاوم للمصل.

                                        قتل الجراثيم من سلالة الوالدين 35000 و DSRA متحولة FX517. تم إجراء قتل مبيد للجراثيم كما في الشكل & # x200B الشكل 1 ، 1 ، باستثناء أنه تم استخدام تركيزات مصل. البيانات الواردة في الشكل & # x200B الشكل 1 1 و & # x200B و 6 6 للسلالة 35000 مع 50 & # x00025 sera هي نفس البيانات. تم الحصول على البيانات المقدمة لـ FX517 في تجارب متوازية مع سلالة 35000.

                                        تكملة DSRA المسوخ.

                                        كان من الممكن حدوث طفرة خفية (بخلاف DSRA طفرة) أثناء بناء FX517 ، والتي يمكن أن تفسر النمط الظاهري الحساس للمصل. علاوة على ذلك ، أردنا تحديد ما إذا كانت حساسية المصل لـ FX517 والثالثة تحدث بشكل طبيعي DSRA يمكن تحويل المسوخ إلى مقاومة مصل إذا أعربوا DSRA. كل DSRA mutant & # x0005bisogenic mutant FX517 أو المسوخات التي تحدث بشكل طبيعي CIP A75 و CIP A77 و CIP 542 (CAN) & # x0005d تم إلكترودتها باستخدام pUNCH 1260 (DSRA) أو البلازميدات pLSKS (مكافحة ناقلات الأمراض). هذه البلازميدات المكوكية قادرة على التكاثر في H. دوكري. تم التعبير عن السلالات التي تحتوي على PUNCH 1260 ، ولكن ليس pLSKS DSRA (الشكل & # x200B (الشكل 7 أ). 7 أ). التعبير عن DSRA من البلازميد pUNCH 1260 اقترح أن المروج المحدد مؤقتًا (الشكل & # x200B (الشكل 3) 3) كان يقود التعبير عن المستنسخة DSRA الجين ، نظرًا لوجود القليل جدًا من DNA المنبع الإضافي وكان الإدخال في الاتجاه المعاكس فيما يتعلق بـ لاكز المروج في pLSKS.

                                        تكملة DSRA المسوخ والقتل للجراثيم. (أ) مجموع البروتينات الخلوية من المشار إليه H. دوكري تعرضت سلالات لـ SDS-PAGE (12 & # x00025 بولي أكريلاميد) والنشاف الغربي بمضاد DsrA المضاد. تم اكتشاف الجسم المضاد المربوط مع الجسم المضاد الثانوي المترافق مع بيروكسيداز الفجل متبوعًا بالتلألؤ الكيميائي. البلازميدات: أ ، لكمة 1260 (تحتوي على كامل DSRA ORF من سلالة 35000 ومروجها الأصلي المفترض كما هو موضح في الشكل & # x200B الشكل 2) 2) B ، pLSKS (متجه بدون إدراج). (ب) قتل الجراثيم للمكمل DSRA المسوخ. تم إجراء قتل مبيد للجراثيم كما في التجربة في الشكل & # x200B الشكل 1 1 (50 & # x00025 مصل) ، باستثناء أن الوسط المستخدم يحتوي على الستربتومايسين. & # x00025 ، نسبة البقاء على قيد الحياة. يتم تجميع البيانات من تجارب منفصلة أجريت في ثلاثة أيام مختلفة على الأقل.

                                        تم إجراء فحوصات مبيد للجراثيم على كل من المكملات DSRA المسوخ (الشكل & # x200B (الشكل 7 ب). 7 ب). التعبير عن DSRA من pUNCH 1260 يمنح مقاومة المصل لجميع السلالات الأربعة & # x0005bFX517 و CIP A75 و CIP A77 و CIP 542 (CAN) & # x0005d. ومع ذلك ، فإن هذه السلالات الأربعة التي تؤوي ناقل البلازميد الذي يفتقر إلى إدراج لم تكن مقاومة. خلصنا إلى أن عيب حساسية المصل في FX517 كان بسبب DSRA طفرة وليس لتأثير قطبي أو طفرة خفية. وبالمثل فإن حساسية المصل تحدث خلل بشكل طبيعي DSRA تم إصلاح المسوخ بواسطة مستنسخ DSRA.

                                        تعبير LOS بواسطة H. دوكري.

                                        في بعض الأنظمة البكتيرية ، تكون الطفرات ذات الطفرات في LOS أكثر عرضة للمصل من السلالات البرية. في الواقع ، فإن النمط الظاهري المصل للإصابة H. دوكري تُعزى سلالات CIP A75 و CIP A77 إلى اقتطاع LOS. كان من الممكن أن عدم وجود DSRA التعبير في DSRA أدت المسوخات & # x0005bFX517 و CIP A75 و CIP A77 و CIP 542 (CAN) & # x0005d إلى اقتطاع LOS بشكل مباشر أو غير مباشر. بدلا من ذلك ، إصلاح DSRA التعبير في LOS DSRA قد تؤثر المسوخات المزدوجة الظاهرة (CIP A75 و CIP A77) على تعبير LOS وقابلية المصل اللاحقة. لمعالجة هذه الاحتمالات ، تم تحليل LOS بواسطة SDS-PAGE وتلطيخ الفضة (الشكل & # x200B (الشكل 8) 8) وفي اللطخات الغربية (البيانات غير معروضة). قارنا 35000 و FX517 LOS (بدون بلازميدات) في العديد من المواد الهلامية الملطخة بالفضة ووجدنا أن أنماط الترحيل كانت متشابهة. علاوة على ذلك ، كانت البقع الغربية من 35000 و FX517 LOS مع مكافحة LOS MAb 3F11 (5) متشابهة (البيانات غير معروضة).

                                        تحليل H. دوكري LOS بواسطة SDS-PAGE. تم تحضير Crude LOS كما هو موصوف في النص وتعرض لـ SDS-PAGE وتلطيخ الفضة. لا شيء ، لا يوجد بلازميد موجود أ ، ثقب 1260 (يحتوي على كامل DSRA ORF من سلالة 35000 ومروجها الأصلي المفترض كما هو موضح في الشكل & # x200B الشكل 2) 2) B ، pLSKS (متجه بدون إدراج).

                                        تكملة أنماط تلطيخ الفضة DSRA كان لا يمكن تمييز المسوخ بين كل زوج من السلالات التي تحتوي على إما لكمة 1260 (DSRA) أو pLSKS ، على التوالي. كان هناك اختلاف طفيف في نطاق LOS سريع الترحيل لإحدى السلالات & # x0005bCIP 542 (CAN) لا يوجد بلازميد & # x0005d عند زراعته على وسط شوكولاتة خالٍ من المضادات الحيوية (قاعدة مولر هينتون) مقارنة بنفس السلالة & # x0005bCIP 542 (CAN) ، إما موجود بلازميد & # x0005d يزرع على وسط شوكولاتة الستربتومايسين (قاعدة متوسطة للمكورات البنية). ومع ذلك ، داخل كل زوج من السلالات المتطابقة (معبرة أو غير معبرة DSRA) ، لم تكن هناك اختلافات كبيرة في LOS. وبالتالي ، في ظل الظروف المحدودة التي تم فحصها هنا ، كان وجود DsrA وليس طول LOS هو المحدد المهيمن لمقاومة المصل.

                                        التحليل الإنشائي لـ DSRA في أخرى H. دوكري سلالات.

                                        النشاف الغربي لمجموعة متنوعة H. دوكري سلالات (الشكل & # x200B (الشكل 1 أ) 1 أ) تشير بقوة إلى أن DsrA تختلف في الكتلة الجزيئية و / أو تسلسل (سلاسل) الأحماض الأمينية بين السلالات. علاوة على ذلك ، أردنا أن نفهم ما إذا كانت الطفرات قد حدثت في الطبيعة DSRA المسوخ أو ما إذا كانت إمكانية اختلاف المرحلة يمكن أن تفسر عدم قدرتها على التعبير DSRA. تم استخدام PCR لتضخيم جزء يحتوي على 1.2 كيلو بايت DSRA من ثماني سلالات إضافية ، بما في ذلك DSRA المسوخات (الشكل 2 ، 2 ، الاشعال 14 و 24) أشار تسلسل الأحماض الأمينية المستخلصة إلى أن بروتين DsrA كان متشابهًا تمامًا بين السلالات (الشكل & # x200B (الشكل 9). 9). لوحظت منطقتان مع تباين متواضع وتم تحديد منطقتين متغيرتين 1 و 2 (VR1 و VR2). وشملت VR1 ، تقريبًا ، الأحماض الأمينية من 90 إلى 100 (حسب السلالة) ، ولوحظ عدد قليل من البدائل والإدخال. VR2 تحتوي على نسخة واحدة أو نسختين أو ثلاث نسخ متطابقة من تسلسل تكرار heptamer NTHNINK والأحماض الأمينية الممتدة من 174 إلى 195 في السلالات المختلفة.ومن المحتمل أن يكون العدد المختلف لتسلسلات التكرار هو العامل السائد الذي يفسر الهجرة المتغيرة التي شوهدت في SDS -PAGE والنشاف الغربي. باستثناء بروتين DsrA في سلالة متحولة CIP 542 (CAN) ، والتي تحتوي على كودون توقف (انظر أدناه) ، كانت متواليات جميع بروتينات DsrA الثمانية الأخرى متطابقة بعد VR2 ، نفس المنطقة التي كانت مشابهة لـ UspA2 و YadA. نستنتج أن DsrA مخدوع للغاية خدم في تسلسل ، على الرغم من حركته المتغيرة في المواد الهلامية.

                                        كود الإيقاف موجود في DSRA سينتج عن طفرة CIP 542 بروتين مبتور يفتقر إلى الأحماض الأمينية C-terminal 15. تشتمل هذه المنطقة من العديد من بروتينات الغشاء الخارجي على إشارة تثبيت مطلوبة للتصدير المناسب لبروتينات الغشاء الخارجي (41 ، 46). قد تؤدي هذه الطفرة إلى عدم استقرار البروتين وتفسير عدم قدرتنا على اكتشافه. فى المقابل، DSRA احتوى كل من الطفرات CIP A75 و CIP A77 على ORF سليمًا من شأنه أن يشفر بروتينًا كامل الطول. ومع ذلك ، كشف فحص منطقة المروج لكل من CIP A75 و CIP A77 أن حذفًا مكونًا من 5 قواعد كان موجودًا بين المناطق المفترضة & # x0221235 و & # x0221210 من منطقة المروج (البيانات غير معروضة) ، مع ترك مسافة 11 فقط. بين متواليات الإجماع. قد يؤدي ذلك إلى تقليل النسخ أو غيابه. في بعض اللطخات الغربية من CIP A75 و CIP A77 ، لوحظ وجود نطاق ضعيف للغاية. ما إذا كان هذا يمثل تعبيرًا ضعيفًا عن DSRA أو التفاعل المتبادل مع بروتين آخر غير معروف.

                                        كان فحص تسلسل الحمض النووي للأشكال النموذجية المتضمنة في تباين الطور غير مجدي. علاوة على ذلك ، أجرينا دراسات قتل متسلسلة للجراثيم باستخدام 10 8 CFU من CIP A75 أو CIP A77 لتحديد متغير مقاوم للمصل (طور) يعبر عن DSRA (البيانات غير ظاهرة). كان الناجون من علاج fNHS المتسلسل أكثر عرضة للإصابة مثل الناجين من معاملة & # x00394NHS ، ولم يتم التعبير عن أي منهم DSRA. هذه البيانات تشير إلى عدم القدرة على التعبير DSRA عن طريق ما يحدث بشكل طبيعي DSRA من المحتمل ألا تكون المسوخات بسبب اختلاف الطور عالي التردد.


                                        نقاش

                                        في الدراسة الحالية ، DYRK2 أظهر أعلى مستوى وتواتر للتضخيم (الشكل 4أ) ⇓ و RNA overexpression (الجدول 3) ⇓ من بين 19 علامة STS / EST / الجينات التي تم فحصها في منطقة 12q13-14. MDM2، من ناحية أخرى ، لم يتم تضمينه في المجال الأساسي المضخم في هذه السلسلة المكونة من 75 ورمًا معديًا مريئيًا و 37 سرطانًا غديًا في الرئة (الشكل 3) ⇓. على الرغم من أن الجين الورمي الموثق جيدًا قد لوحظ أنه يتم تضخيمه بشكل متكرر عند مستويات عالية (& GT30 ضعفًا) في الأورام اللحمية (33.3٪) والأورام الدبقية (8-10٪ المرجعان 14 و 33) ، فإن النتائج التي توصلنا إليها تتوافق مع منشورين سابقين في التي تضخيم MDM2 لوحظ في 0-4 ٪ فقط من أورام المريء الغدية (15 ، 16). تضخيم نادر أو غائب MDM2 تم توثيقه أيضًا في العديد من السرطانات البشرية الأخرى ، بما في ذلك سرطان المريء الحرشفية (0 من 24 أورام المرجع 34) ، أورام إوينغ الأولية (0 من 37 أورام المرجع 35) ، سرطان عنق الرحم الأولي (0 من 35 أورام المرجع 36) ، الثدي السرطانات (1 من 60 أورام المرجع 37) ، وأورام الكبد (0 من 19 أورام المرجع 38). الدراسة الحالية هي الأولى التي حددت الجينات المختارة بواسطة تضخيم 12q14 بالقرب من MDM2 في أورام المريء والرئة.

                                        ال DYRK تتضمن العائلة الكينازات المنظمة للتيروزين (Y) - الفسفرة ذات الخصوصية المزدوجة ، والتي تتميز عن عائلات بروتين كينيز الأخرى من خلال قدرتها على فسفوريلات كل من ركائز Ser / Thr و Tyr (خصوصية مزدوجة) ، وتشمل ما لا يقل عن سبعة أعضاء من الثدييات ، DYRK1A, DYRK1B, DYRK1C, DYRK2, DYRK3, DYRK4A، و DYRK4B (41). بالإضافة الى، DYRK1A, DYRK2, DYRK3, MNB، و الياكا يمكن أن يقوم autophosphorylate بقايا التيروزين الخاصة بهم في المختبر (39 , 41) . الياكا قد يكون متماثل DYRK2 أو DYRK3، وجميع الثلاثة هم في الغالب السيتوبلازم ، بينما DYRK1A يظهر التوطين النووي (40 ، 41). DYRK1A هو تجانس ذبابة الفاكهة MNB، والتي تم تعيينها إلى المنطقة الحرجة لمتلازمة داون البشرية 21q22.2 (42 ، 43). في الوقت الحالي ، لا تزال الوظيفة الخلوية لجميع أفراد عائلة DYRK غير واضحة. ومع ذلك ، فقد تم تورط DYRK1A في تكوين الخلايا العصبية للجنين الطبيعي (44) وكجينة مرشح محتمل مسؤولة عن متلازمة داون (45). قد تشارك عائلة DYRK أيضًا في النمو المبكر للقلب (46) وقد تلعب دورًا في تنظيم دورة الخلية (47). تم الإبلاغ عن DYRK1A لتفسفر عامل النسخ FKHR في Ser329 في المختبر (48). تم إثبات أن كلا من DYRK1A و DYRK2 يقومان بفوسفوريلات STAT3 في المختبر (49). قد يكون DYRK1A متورطًا بشكل مباشر في تنظيم نشاط النسخ لـ Gli1 ، وهو عامل نسخ هدف لمسار القنفذ الصوتي المتضمن في تطور سرطان الخلايا القاعدية (50 ، 51 ، 52). ومن المثير للاهتمام، ميرك، وهو كيناز مستنسخ حديثًا متعلق بالدماغ المصغر والذي يشبه توطينه الخلوي DYRK2 و DYRK3 ، يتم التعبير عنه بشكل مفرط في سرطانات القولون الأولية ويمكن أن يتوسط بقاء خطوط خلايا سرطان القولون تحت الظروف الناجمة عن الإجهاد (53). ذكرت دراسة حديثة أن DYRK2 تم تنظيم mRNA في خلايا الورم الأرومي العصبي عن طريق معالجة الخلايا بعامل مضاد للسرطان ، 8-Cl-cAMP ، وهو نظير AMP دوري انتقائي للموقع يعرض تثبيطًا للنمو في مجموعة واسعة من خطوط السرطان البشرية (54). تشير هذه الملاحظات ، جنبًا إلى جنب مع النتائج التي توصلنا إليها ، إلى دور محتمل لـ DYRK2 في تطور ورم الرئة والمريء و / أو تطوره.


                                        المواد والأساليب

                                        استنساخ متغيرات MutL و-clamp cysteine

                                        ترميز التعبير البلازميدات بكتريا قولونية β-clamp و MutL كانت هدايا لطيفة من الدكتور مايكل أودونيل والدكتور وي يانغ ، على التوالي. تم إنشاء متغيرات من كلا البروتينين ، حيث تم استبدال السيستين المكشوفة السطحية بالسيرين ، عن طريق تداخل PCR. بكتريا قولونية β (pAG 8769 بقايا 1-367) التي تأوي طفرات C260S و C333S و L366S و C367 تم استنساخها جزئيًا في ناقل pET15b معدل يفتقر إلى علامة الهيستدين. بكتريا قولونية تم استنساخ MutL (مخلفات pAG 8814 1-615) ، ومجالها الطرفي C MutL CTD (pAG 8768 بقايا 431-615) ، بما في ذلك الطفرات C61S و C446S و C588S في pET15b باستخدام NdeI و BamHI. المتغيرات من بكتريا قولونية تم إنشاء MutL (eMutL * pAG 8824) و MutL CTD (eMutL CTD * pAG 8772) التي تفتقر إلى فكرة الربط β (482 QPLLIP → 482 ASAAA) عن طريق تداخل PCR.

                                        المتغيرات من B. الرقيقة تم إنشاء MutL و بقايا السيستين المكشوفة السطحية بالمثل. B. الرقيقة β (pAG 8807 بقايا 1-380) بما في ذلك Ser379 – Cys380 ثنائي الببتيد عند الطرف C المتطرف للبروتين تم استنساخه جزئيًا في ناقل pET15b معدل بما في ذلك علامة هيستيدين قابلة للإزالة TEV. B. الرقيقة تم استنساخ MutL (مخلفات pAG 8842 1-627) ، ومجالها الطرفي C MutL CTD (pAG 8803 بقايا 433-627) ، بما في ذلك الطفرات C69S و C424S و E485C و C531S في ناقل pProExHTa. تم إنشاء متغير غير نشط لـ MutL CTD بما في ذلك طفرتين نقطيتين إضافيتين (C573S و C604S) ، MutL CTDI (مخلفات pAG 8927 433-627) ، عن طريق الطفرات الموجهة للموقع. المتغيرات من B. الرقيقة تم إنشاء MutL (bMutL * pAG 8908) و MutL CTD (bMutL CTD * pAG 8909) و MutL CTDI (bMutL CTDI * pAG 8929) التي تفتقر إلى نموذج الربط β (487 QEMIVP → 487 AEMAAP) عن طريق تداخل PCR. تم التحقق من جميع المسوخات عن طريق تسلسل الحمض النووي (MOBIX ، جامعة ماكماستر).

                                        توصيف متغيرات MutL و β-clamp cysteine

                                        بكتريا قولونية و B. الرقيقة تم إنتاج المتغيرات المعدلة β و MutL cysteine ​​بشكل مفرط وتنقيتها كما هو موصوف سابقًا (10 ، 24 ، 27 ، 28) وتم التخلص منها من عمود كروماتوجرافي لاستبعاد الحجم في أحجام الاحتفاظ المماثلة لنظيراتها الأصلية (الشكل التكميلي S1). كانت جميع متغيرات السيستين المنقى أحادية التشتت في المحلول كما تم الحكم عليه من خلال تشتت الضوء الديناميكي باستخدام Zetasizer Nano S (Malvern Instruments). تم غزل البروتينات المنقية (60 ميكرومتر) عند 15700 × جم لمدة 10 دقائق وكانت القياسات على 12 ميكرولتر من خلايا الكوارتز عند 4 درجات مئوية. تم حساب توزيع حجم العينات بناءً على وظيفة الارتباط التي يوفرها برنامج Zetasizer. باستخدام نظرية مي ، تم تحويل التوزيع المعتمد على الكثافة إلى توزيع حجم للنظر في النسبة النسبية للمكونات المتعددة المحتملة في العينة (الشكل التكميلي S1).

                                        تم تقييم الثبات الحراري للعينات المختلفة عن طريق مسح قياس التألق التفاضلي باستخدام CFX96 Real-Time System (BioRad) (32). تم تبادل البروتينات إلى 20 ملي مولار من درجة الحموضة 8.0 ، 150 ملي كلوريد الصوديوم ، 5٪ جلسرين (لـ بكتريا قولونية البروتينات) أو 20 ملي تريس pH 7.6 ، 150 ملي بوكل ، 10٪ جلسرين (لـ B. الرقيقة البروتينات) باستخدام عمود الترشيح الهلامي Superdex-200 (GE Healthcare). تم تحضين صبغة هلام البروتين البرتقالية SYPRO (4.8 ×) من المجسات الجزيئية بـ 4.8 ميكرومتر من البروتين وتعرضت المخاليط لتدرج درجة الحرارة من 4 إلى 95 درجة مئوية على مدى 90 دقيقة. تم قياس مضان العينة بمرور الوقت باستخدام إعداد الحنق. تم إجراء كل تفاعل في أربع مكررات ويتم تقديم منحنيات تمثيلية في الشكل التكميلي S1.

                                        تحليل وظيفة البديل السيستين بكتريا قولونية β في الجسم الحي

                                        قدرة بكتريا قولونية β لدعم الجدوى تم قياسه باستخدام مقايسة خلط البلازميد (33) (الجدول 1). باختصار ، السلالة MS201 تفتقر إلى جين وظيفي β-clamp (dnaN) ، بسبب طفرة الإطارات (dnaN −1FS ). تعتمد جدوى السلالة MS201 على pAMP البلازميد المقاوم للأمبيسيلينdnaN + ، والذي يعبر عن المستويات الفسيولوجية للنوع البري β-clamp (34). MS201 تحمل pAMPdnaN + تم تحويله باستخدام pACM غير المتوافق والمقاوم للكلورامفينيكول (تحكم سلبي) ، pACMdnaN + (eβ WT) أو pACMβ Cys (eβ Cys) البلازميدات ، والتي تحتوي على نفس أصل النسخ المتماثل مثل pAMPdnaN + . تم تمرير عشرين من المحولات المختارة عشوائياً 100 جيل في وسط Luria-Bertani (LB) مع 40 ميكروغرام / مل من الكلورامفينيكول. تردد pAMPdnaN + تم قياس الاستبقاء عن طريق ترقيع الخلايا على ألواح أجار المكملة إما بالأمبيسيلين 150 ميكروغرام / مل (للتسجيل لـ pAMPdnaN + ) أو 40 ميكروغرام / مل كلورامفينيكول (تحكم). حضور dnaN −1FS الأليلات ، ونقص pAMPdnaN + البلازميد ، في سلالات تحمل pACMdnaN + أو تم التحقق من pACMβ Cys عن طريق تحليل PCR التشخيصي وتسلسل النيوكليوتيدات للكروموسومات dnaN locus ، بالإضافة إلى تحليل تسلسل البلازميد المصغر والنيوكليوتيد ، كما هو موضح سابقًا (33).

                                        تم استخدام عزلات مفردة من سلالات eβ WT (VB100) و eβ Cys (VB101) للتحليلات الجينية اللاحقة (الجدول 2). تواتر الطفرة العفوية rpoB لمقاومة ريفامبيسين (Rif R) للسلالات VB100 و VB101 تم قياسها (35) ، وتم حساب حدود الثقة 95٪ كما هو موضح سابقًا (36). تم حساب معدلات الطفرة باستخدام FALCOR ، وهو مقدر احتمالية قصوى Ma-Sandri-Sarkar (37). تم استخدام اختبار Mann – Whitney U (http://www.socscistatistics.com/tests/mannwhitney/Default.aspx) لتحديد ما إذا كانت اختلافات معدل الطفرات ذات دلالة إحصائية. تم قياس مستويات الحالة الثابتة لبروتينات β-clamp باستخدام تحليل لطخة غربية (33). تم حساب مرات مضاعفة السلالات VB100 و VB101 المزروعة عند 37 درجة مئوية في وسط LB السائل من الأجزاء الخطية لمنحنيات النمو.

                                        B. الرقيقة سلالات ، علم الجراثيم والنشاف الغربي لتحليل متغيرات السيستين B. الرقيقة موتل و β في الجسم الحي

                                        كل B. الرقيقة تم إنشاء السلالة عن طريق تضخيم أليل متحور من البلازميدات (pAG 8807 ، pAG 8842). ل JRR20 ، متحولة dnaN تم وضع الأليل في البلازميد pBGSC6 الذي يحتوي على علامة مقاومة الكلورامفينيكول وتم دمجه في الأصل dnaN المكان عبر كروس واحد. تم بناء JRR21 عن طريق وضع المسوخ mutL أليل في البلازميد pMiniMad مع تسلسل المنبع والمصب والاندماج في الأصلي mutL موضع عبر كروس مزدوج. تم إنشاء JRR28 عن طريق تنقية الحمض النووي الجيني من JRR20 وتحويل الحمض النووي الجيني إلى خلايا JRR21 المختصة واختيار مقاومة الكلورامفينيكول. تم صنع PB112 عن طريق وضعه في المنبع والمصب mutL التسلسل في pMiniMad وإزالة الجين عن طريق التقاطع المزدوج في الموقع الأصلي. تم التحقق من جميع السلالات عبر تحليل تسلسل الحمض النووي وهي مدرجة في الجدول التكميلي S3.

                                        تم إجراء تحليل منحنى النمو عن طريق تنمية كل سلالة في الثقافة في 3 مل من سائل LB ونمت إلى OD600 بين 0.4 و 0.6. ثم تم تخفيف كل ثقافة إلى OD600 تم توزيع 0.05 وخمسة 200 ميكرولتر في آبار صفيحة معقمة بها 96 بئر لكل سلالة. تم تحضين هذه اللوحة عند 37 درجة مئوية ، واهتزت طوال الليل وتم أخذ الامتصاص عند 600 نانومتر كل 0.5 ساعة بواسطة قارئ ألواح أوميغا. تم حساب الانحراف المعياري بين الكتل الخمسة ورسمه.

                                        تم إجراء النشاف الغربي عن طريق تنمية كل سلالة إلى OD600 من 0.8 إلى 1. ثم تم تطبيع رقم الخلية إلى 1 مل من OD600 يساوي 1 لكل سلالة وتم تكوير الخلايا بالطرد المركزي لمدة دقيقتين عند 14000 قدم مكعب. تم استنشاق المادة الطافية وتم إعادة تعليق الخلايا في 50 ميكرولتر من محلول التحلل (50 ملي مولار تريس - حمض الهيدروكلوريك pH 8 ، 150 ملي كلوريد الصوديوم ، 50 ملي EDTA ، 1 × كوكتيل مثبط البروتياز (Thermoscientific) ، 10 مجم / مل الليزوزيم). تم تحضين الخلايا بعد ذلك عند 37 درجة مئوية لمدة 30 دقيقة ثم تركت على الجليد لمدة 10 دقائق. تم بعد ذلك طرد محلول الخلية عند 14000 قدم مكعب لمدة 5 دقائق لإزالة حطام الخلية. تمت إضافة 50 ميكرولتر من 10 ٪ SDS ، وتحميل الصبغة إلى 1 × وتم تسخين العينات إلى 100 درجة مئوية لمدة 10 دقائق قبل التحميل على 8 ٪ SDS-PAGE. تم نقل البروتين إلى غشاء النيتروسليلوز وتم حظره لمدة 30 دقيقة في TBST مع 5٪ حليب. تم تحضين الغشاء بعد ذلك في التخفيف المضاد (1/250 لـ α-MutL ، و 1/250 لـ α-DnaX ، و 1/1000 α-DnaN) في TBST مع 5٪ حليب طوال الليل عند 4 درجات مئوية. تم غسل الغشاء باستخدام TBST واحتضانه بتخفيف 1/15000 من الجسم المضاد الثانوي المسمى IR (LiCOR) في TBST مع 5٪ حليب لمدة ساعة عند درجة حرارة الغرفة. تم بعد ذلك غسل الغشاء مرة أخرى في TBST وتصور باستخدام مصور صبغة الأشعة تحت الحمراء.

                                        تحديد B. الرقيقة معدل الطفرة

                                        تم إجراء معدل الطفرة وحسابها بشكل أساسي كما هو موضح (38). باختصار ، نمت كل سلالة بين عشية وضحاها للمستعمرات المفردة على أجار LB بالمضادات الحيوية المناسبة عند 30 درجة مئوية. بعد النمو بين عشية وضحاها ، تم اختيار مستعمرة واحدة لكل سلالة لكل تكرار ونمت في 3 مل ثقافة LB السائل إلى OD600 بين 0.8 و 1.2 (النمو الأسي المتأخر) عند 37 درجة مئوية. تمت إزالة 1.5 مل من كل مزرعة وتكويرها بالطرد المركزي لمدة 4 دقائق عند 8000 قدم مكعب. تم استنشاق المادة الطافية وتم تعليق الخلايا في 100 ميكرولتر من محلول ملحي بنسبة 0.85 ٪. تم تخفيف 1 ميكرولتر من هذا المحلول بمقدار 10 6 أضعاف وتم طلاء 100 ميكرولتر على أجار LB للحصول على عدد إجمالي الخلايا القابلة للحياة. تم بعد ذلك طلاء 100 ميكرولتر من إعادة تعليق الخلية على 100 ميكروغرام / مل من ريفامبيسين LB أجار لتحديد عدد وحدات تشكيل مستعمرة الريف R. تم إجراء تحليل معدل الطفرة (39) باستخدام طريقة مقدر الاحتمالية القصوى Ma-Sandri-Sarkar (MSS-MLE) الموصوفة في (37). بالنسبة للتحكم في النوع البري PY79 ، تم تحليل 32 مكررًا ، و 14 مكررًا لـ ΔmutL، 31 من أجل dnaN Cys ، 24 من أجل mutL Cys و 9 من أجل dnaN السيستئين ، mutL السيستئين.

                                        تشكيل مركب MutL-β

                                        لتشكيل مجمعات MutL-و MutL CTD -β ، تم تحضين β إما باستخدام MutL أو MutL CTD بنسبة 1: 1 إلى تركيز نهائي قدره 20 ميكرومتر. تم غسيل العينات (1-2 مل) مقابل 1 لتر من محلول غسيل الكلى A (20 ملي مولار تريس أس هيدروجيني 8.0 ، 150 ملي مول كلوريد الصوديوم ، 10 ملي مولار DTT ، 5٪ جلسرين من أجل بكتريا قولونية بروتينات أو 20 ملي تريس pH 7.6 ، 150 ملي بوكل ، 10 ملي مولار DTT ، 10٪ جلسرين B. الرقيقة البروتينات) لمدة ساعتين عند 4 درجات مئوية. تم نقل الخليط إلى محلول غسيل الكلى B (مثل A ولكن مع 5 ملي مولار DTT) لمدة ساعة واحدة ، تليها ساعة واحدة في محلول غسيل الكلى C (بدون DTT). ثم تُركت العينة طوال الليل في محلول غسيل الكلى C. تمت مراقبة التكوين المعقد بمرور الوقت عن طريق تحليل العينات عند 11٪ (بكتريا قولونية MutL-β و B. الرقيقة MutL CTD -β) أو 15٪ (بكتريا قولونية MutL CTD -β) تغيير طبيعة المواد الهلامية الملطخة بـ Coomassie Brilliant Blue. قبل تشكيل بكتريا قولونية تم احتضان MutL − β المعقد كامل الطول (43 ميكرومتر) مسبقًا في غياب ووجود 2 مم AMPPNP (Sigma) لمدة ساعة واحدة في درجة حرارة الغرفة متبوعًا بحضانة طوال الليل عند 4 درجات مئوية. اقتران المجالات N- المحطة الطرفية بكتريا قولونية تمت مراقبة MutL كما هو موضح سابقًا (26 ، 28).

                                        جمع وتحليل بيانات SAXS

                                        بكتريا قولونية تم حل عينات MutL CTD-على عمود كروماتوجرافي استبعاد حجم Superdex-200 (GE Healthcare). B. الرقيقة عولجت عينات MutL CTDI-باستخدام 120 ميكرومتر من ميثيل ميثانيثيوسلفونات (MMTS) لمدة 10 دقائق عند 22 درجة مئوية لمجموعات ثيول غير المتفاعلة سلفينيلات وتم حلها على عمود تبادل أيوني Mono Q 5/50 GL (GE Healthcare) متوازن مع المخزن المؤقت D (20) مم تريس الأس الهيدروجيني 7.6 ، 150 مم بوكل ، 0.5 ملي مولتر EDTA ، 1 مم MMTS ، و 10٪ جلسرين). B. الرقيقة تم تبادل عينات MutL CTDI-في المخزن المؤقت D باستخدام مكثف 100 كيلو دالتون MWCO. تم تأكيد تجانس العينة عن طريق تشتت الضوء الديناميكي (Malvern Instruments). تم غزل العينات (35 ميكرولتر) عند 15700 × جم لمدة 10 دقائق وتم جمع بيانات التشتت على أداة Rigaku BioSAXS-1000 عند 10 درجة مئوية. تم جمع عمليات مسح متتالية من 10 و 30 و 60 و / أو 180 دقيقة عبر مجموعة من تركيزات البروتين (eβ: 47–186 ميكرومتر eMutL CTD: 91–364 ميكرومتر eMutL CTD -β (يوم 1): 1.8 - 2.0 ميكرومتر eMutL CTD - β (يوم 2): 9.5-123 ميكرومتر bβ: 27-73 ميكرومتر bMutL CTDI: 88-218 ميكرومتر bMutL CTDI -β: 22–37 ميكرومتر (يوم 2)). تم استخدام SAXSLab 3.0.0r1 (Rigaku) ​​لتوليد منحنيات التشتت. أكدت مقارنة حالات التعرض لمدة 10 دقائق التي تم جمعها قبل وبعد جمع البيانات وحل العينات على المواد الهلامية SDS-polyacrylamide قبل وبعد جمع البيانات سلامة العينة أثناء جمع البيانات. كانت أزواج ملف تعريف الانتثار 1D متطابقة لجميع العينات. تم تقييم جودة البيانات من خلال مقارنة منحنيات التشتت على مجموعة من تركيزات البروتين وأوقات التعرض باستخدام مجموعة برامج ATSAS 2.6.0 (الأشكال التكميلية S3 - S5) (40). تم تحديد نصف قطر الدوران ووظائف التوزيع بين الزوجين باستخدام Primus و Gnom (الجدول 3 والجدول التكميلي S2) (41). تم استخدام أعلى تقدير للجودة على النحو المحدد بواسطة وظائف AutoRg و AutoGNOM لتحديد العينات التي تمت معالجتها بشكل أكبر. للعينات المختارة ، عشرين البداية تم إنشاء النماذج بشكل مستقل لكل عينة باستخدام DAMMIN أو DAMMIF أو GASBOR (42-44). البداية تم تجميع نماذج bMutL CTDI و bβ و eMutL CTD -eβ بناءً على التناقض المكاني الطبيعي باستخدام DAMCLUST (45) وتم تقديم النموذج التمثيلي للمجموعة المهيمنة. تم إنشاء النماذج المكررة لـ eβ و eMutL CTD و bMutL CTDI -bβ باستخدام DAMMIN (43) باستخدام ملف damstart.pdb كحجم بدء البحث. تم إنشاء نمذجة الهيكل الرباعي لمركب bMutL CTD- باستخدام bMutL CTD (PDB 3KDK) و bβ (PDB 4TR6) باستخدام SASREF (46). تم حساب الأوزان الجزيئية المبلغ عنها بناءً على حجم الارتباط (47).

                                        فحص نوكلياز موتل

                                        تم إجراء فحوصات نوكلياز MutL المستقلة عن عدم التطابق كما هو موضح سابقًا (31) مع تعديلات طفيفة. تم تضخيم ركيزة الحمض النووي الخطي (200 زوج أساسي) من ناقل pUC19 (Invitrogen) باستخدام 32 P نهاية المسمى 5′-P-d (ATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACG) و 5′-P-d (CGGCAACA ATTAATAGACTGGATGGAGGCG). تم تحضين MutL (152-606 نانومتر) ، MutL * (152-303 نانومتر) ، MutL-(152-606 نانومتر) ، و MutL CTD (1.15 - 2.3 ميكرومتر) باستخدام DNA (10 نانومتر) في غياب ووجود كميات متساوية من β في المخزن المؤقت للتفاعل (20 مللي مولار تريس pH 7.6 ، 30 مللي مولار بوكل ، 0.5 مللي مولار ATP ، 1 مللي مولار MnCl2، 1 ملي MgCl2، 1 ملي Zn (O2CCH3)20.05 مجم / مل من مساحة سطح الجسم ، 4٪ جلسرين). بعد حضانة لمدة ساعة عند 37 درجة مئوية ، توقف التفاعل مع 25 ملي مولار EDTA و 1 مجم / مل بروتيناز K (55 درجة مئوية لمدة 20 دقيقة). تمت إضافة صبغة تحميل مرتين (90٪ فورماميد ، 0.025٪ بروموفينول أزرق ، 0.025٪ زيلين سيانول FF ، 0.5 مم EDTA ، 10٪ جلسرين) وحل مخاليط التفاعل على 8٪ بولي أكريلاميد (8 م يوريا) هلام في 0.5 × تريس- بورات- EDTA العازلة. تم تصور المواد الهلامية باستخدام Typhoon Trio + (GE Healthcare). تم إجراء جميع التجارب في ثلاث نسخ.

                                        مقايسة التحلل المائي ATP

                                        تم إجراء نشاط التحلل المائي ATP كما هو موضح سابقًا (28) مع تعديلات طفيفة. بكتريا قولونية تم تحضين MutL و MutL-β (1 ميكرومتر) باستخدام MgCl2 (5 ملم) و α- 32 P المسمى ATP (62.5-2000 ميكرومتر) في محلول التفاعل (20 ملي مولار تريس درجة الحموضة 8.0 ، 90 ملي مولار بوكل ، 0.1 مجم / مل BSA ، 5٪ جلسرين). تم تحضين التفاعلات (15 ميكرولتر) في درجة حرارة الغرفة لمدة ساعتين وحلها كروماتوجرافيا الطبقة الرقيقة في 0.75 M KH2ص4. تم تصور تراكم ADP باستخدام Typhoon Trio + (GE Healthcare) وقياسه باستخدام ImageJ (//rsbweb.nih.gov/ij/). تم إجراء جميع التجارب في ثلاث نسخ وتمثل أشرطة الخطأ الانحراف المعياري للمتوسط.

                                        فحوصات ربط الحمض النووي والهليكاز

                                        تم تضخيم ركيزة الحمض النووي (250 زوجًا أساسيًا) من ناقل pUC19 (Invitrogen) باستخدام بادئات 5′-d (GCTTAATCAGTGAGGCACCTATCTCAGCG) و 32 P 5 نهاية المسمى 5′-P-d (CGGCAACAATTAATAGACTGGATGGAGGCG). تم تحضين الحمض النووي (5 نانومتر) مع بكتريا قولونية مجمع MutL و MutL-من 40 إلى 320 نانومتر في المخزن المؤقت للتفاعل (20 مم تريس pH 8.0 ، 90 ملي بوكل ، 15 ٪ جلسرين). ال بكتريا قولونية تم تحضير مركب MutL-المستخدم لهذه الاختبارات عن طريق تجميد خليط من eMutL و eβ بعد الحضانة لمدة 24 ساعة في غياب عوامل الاختزال (وهذا يعادل عينة "اليوم الأول" المستخدمة في تحليل SAXS). للتأكد من أن بكتريا قولونية يربط مركب MutL-DNA ، وقد تم تحضين المركب باستخدام DNA عند 22 درجة مئوية لمدة 10 دقائق متبوعًا بـ 30 دقيقة على الجليد. تم حل العينات (15 ميكرولتر) على 4.5 ٪ من المواد الهلامية tris-borate-EDTA وتم تصورها باستخدام Typhoon Trio + (GE Healthcare). تم إجراء جميع التجارب في ثلاث نسخ.

                                        تم إجراء فحوصات Helicase كما هو موضح سابقًا (28) مع تعديلات طفيفة. كان ناقل التعبير UvrD (pWY 1365) هدية طيبة من الدكتور وي يانغ. تم تقطيع الركيزة 250 زوج قاعدي الموصوفة أعلاه بالقرب من المركز باستخدام Nb.BsrDI (New England Biolabs).تم تحضين ركيزة DNA المكسورة (5 نانومتر) مسبقًا بكميات متزايدة من أي منهما بكتريا قولونية MutL أو MutL-(5-80 نانومتر) لمدة 20 دقيقة عند 22 درجة مئوية في المخزن المؤقت للتفاعل (20 ملم تريس الأس الهيدروجيني 7.5 ، 50 ملي كلوريد الصوديوم ، 3 ملي مولار كلوريد الصوديوم2، 0.1 مجم / مل من مساحة سطح الجسم). بدأ فك اللف عن طريق إضافة 5 نانومتر UvrD. تم تحضين التفاعلات (10 ميكرولتر) لمدة 35 دقيقة عند 37 درجة مئوية وتم حلها على 4.5 ٪ من المواد الهلامية tris-borate-EDTA. تم تصور المواد الهلامية باستخدام Typhoon Trio + (GE Healthcare) وقياسها باستخدام ImageJ (//rsbweb.nih.gov/ij/). تم إجراء جميع التجارب في ثلاث نسخ وتمثل أشرطة الخطأ الانحراف المعياري للمتوسط.


                                        تحديد طفرة الطماطم التي تعاني من نقص ABA المواقع كعضو في عائلة جين ABA-aldehyde oxidase باستخدام التحليل الجيني والجيني

                                        ال المواقع (يجلس) طافرة ماكرة من الطماطم (Solanum lycopersicum L.) ناقصًا في نشاط الإنزيم الوظيفي في الخطوة الأخيرة في التخليق الحيوي لحمض الأبسيسيك (ABA). يعتقد أن الآفة البيوكيميائية هي ضعف الألدهيد أوكسيديز (AO). أظهر رسم الخرائط الجزيئية باستخدام تقاطعات مختلفة بين الأنواع سابقًا يجلس للمشاركة في الخريطة مع مجموعة من علامات RFLP التي لم يتم حلها على الذراع القصير للكروموسوم 1. هنا ، يتم استخدام خطوط التجسير لإنتاج خرائط بين الأنواع التي تتضمن مجموعة متوافقة ذاتيًا S. peruvianum سمح الانضمام (LA2157) بالتخطيط الدقيق لـ يجلس داخل هذه المجموعة. تحديد جين AO جديد ، داخل المنطقة المعروفة الآن باحتوائها على يجلس locus ، من خلال تحليل مجموعة تسلسل بندقية الجينوم الكامل للطماطم. يشترك بروتين AO الجديد هذا بنسبة 76-78٪ على مستوى الأحماض الأمينية مع بروتينات AO للطماطم المميزة سابقًا. تسلسل الحمض النووي لهذه الصورة المفترضةهو - هي تم تمييز الجين في النوع البري وفي اثنين من الأليلات يجلس المسوخ (يجلس و يجلس w): تم تحديد التغييرات في تسلسل الحمض النووي في هذه الأليلات الطافرة التي تسبب اقتطاع exon 2 وحذف exon 7 ، على التوالي. هذه النتائج تحدد هوية الطماطم يجلس الجين وتتوافق مع وظيفتها المقترحة لتشفير ألدهيد أوكسيديز ABA apoإنزيم.

                                        هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


                                        الكروموسومات الجنسية وتحديد الجنس في النباتات

                                        أكثر من 95٪ من أنواع كاسيات البذور وعاريات البذور هي خنثى ، تحمل أزهارًا مع حبوب اللقاح والبويضات (كما هو الحال في نبات الأرابيدوبسيس أو القمح) ، أو أحادية النوع حيث يتم حمل أزهار الذكور والإناث على نفس النبات (كما في الذرة) (Dellaporta و Calderon - يوريا ، 1993). حوالي 4 ٪ من النباتات ثنائية المسكن ، حيث يتم حمل أزهار الذكور والإناث على نباتات مختلفة ، وفي معظم هذه النباتات ، يتم تحديد الجنس وراثيًا. يُعتقد أن Dioecy قد تطورت مؤخرًا نسبيًا وبشكل مستقل في عدد من العائلات النباتية. في حالات قليلة ، تم العثور على الكروموسومات الجنسية ثنائية الشكل كما هو الحال في الأمثلة "الكلاسيكية" لـ رومكس الأنواع و سيلين لاتيفوليا، إلى جانب حمال, القنب و كوكسينيا (انظر الشكل 3 ب Kejnovsky and Vyskot، 2010 Navajas-Pérez وآخرون.، 2005، 2009 Vyskot and Hobza، 2004). عند وجود كروموسومات جنسية متماثلة الشكل خلويًا ، توجد اختلافات جينية وجينات محددة للجنس ، بما في ذلك منطقة MSY (منطقة Y الخاصة بالذكور) في النباتات الذكرية والأنثوية. تم وصف هذه المناطق غير المتجانسة التي تشبه الكروموسوم الجنسي في العديد من نباتات المحاصيل التي تم تسلسل جينوماتها مثل البابايا والعنب والحور (العنب: Jaillon وآخرون.، 2007 البابايا ، مينج وآخرون.، 2008 حور ، يين وآخرون.، 2008) ، وكذلك الهليون والكيوي والسبانخ.

                                        البابايا ثلاثية مع XX أنثى ، ذكر XY ، و XYh خنثى (Liu وآخرون.، 2004 تشانغ وآخرون.، 2008). Y هو شاب تطوريًا ويقدر أنه قد تباعد عن X 2–3 ملايين سنة. داخل منطقته الخاصة بالذكور ، تم العثور على حوالي 13 ٪ من Y ، بما في ذلك السنترومير ومقابض متغايرة اللون عالية الميثيل (Zhang وآخرون.، 2008) والعديد من عمليات إعادة ترتيب الكروموسومات (Yu وآخرون.، 2008). في الحور ، يين وآخرون. (2008) حددت منطقة من كروموسوم واحد تظهر خصائص كروموسوم جنسي مع موضع مرتبط بالجنس. لوحظ انخفاض إعادة التركيب ، والفصل المشوه والتباعد في النمط الفرداني فقط في الأنثى ، وبالتالي تحديد الجنس في حور هو نظام كروموسوم ZW أولي حيث يكون الذكور ZZ والإناث من جنس ZW غير المتجانسة.

                                        حدث تطور كروموسوم الجنس النباتي مؤخرًا ، ولا يزال مستمراً ، لذلك يوفر نموذجًا ممتازًا لدراسة تسلسل الحمض النووي وتطور الكروموسوم. يُعتقد أن العملية بدأت بظهور الجينات المحددة للجنس (X لديها عقم عند الذكور وخصوبة الإناث Y لها عامل ذكور ومثبط للإناث) متبوعًا بقمع إعادة التركيب في المنطقة المحيطة بها (للمراجعة ، انظر Bergero and Charlesworth، 2009 Kejnovsky and فيسكوت ، 2010 نافاجاس بيريز وآخرون.، 2005 ، 2006). وبالتالي فإن الكروموسومات الجنسية المتجانسة الخلوية مع مناطق الحمض النووي غير المتجانسة يمكن أن تمثل هذه الخطوة الأولى وغالبًا ما يتم العثور عليها في الواقع على أنها أصغر من الكروموسومات الجنسية ثنائية الشكل. من المفترض أن يؤدي التوسع في قمع إعادة التركيب إلى غالبية الكروموسوم إلى تراكم الطفرات الضارة ، وتآكل الجينات الناجم عن إدخال العناصر الرجعية أو ترانسبوزونات الحمض النووي وأخيراً الانحطاط. ونتيجة لذلك ، تظهر كروموسومات الجنس غير المتجانسة والتي غالبًا ما تكون أكبر من الجسيمات الذاتية في النباتات (الشكل 3 ب) بسبب تراكم عناصر الحمض النووي المتكررة (انظر أدناه) وتتناقض مع الثدييات الصغيرة Ys الأكبر سنًا والتي تم السماح لها بالخسارة الجينات عن طريق إعادة الترتيب (بيرجيرو وتشارلزوورث ، 2009).

                                        أظهرت التحقيقات الجزيئية أن الكروموسوم Y لـ سيلين لاتيفوليا يُقدَّر أن عمره بحوالي 10 ملايين سنة يظهر جميع العلامات المذكورة أعلاه لتطور كروموسوم الجنس بما في ذلك الانحلال الجيني ، والحد من تعدد أشكال الحمض النووي ، وتراكم الطفرات في المواقع الوظيفية الهامة التي ترميز البروتينات ، وتغييرات التعبير الجيني (انظر Armstrong and Filatov، 2008 Filatov وآخرون.، 2009). تحليل توزيع الحمض النووي المتكرر ومقارنة تسلسل الحمض النووي للإناث والذكور على S. Latifolia كشفت الكروموسومات الجنسية أن أجزاء من كروموسوم Y قد تباعدت عن X في أوقات مختلفة ويمكن تقسيمها إلى "طبقات" مشابهة لطبقة Y البشرية. كميات مختلفة من عائلات تسلسل الحمض النووي المختلفة ، تقريبًا من جميع فئات التكرارات المعروفة في النباتات ، موجودة على Y بأعداد كبيرة. سيرماك وآخرون. (2008) أجرى مسحًا لجميع التكرارات على Y لـ S. Latifolia ووجدت في تناقص الوفرة ، التكرار الترادفي الفرعي الفرعي ، الغجر و copia مثل العناصر الرجعية ، تليها LINEs و SINEs و ترانسبوزونات DNA بما في ذلك القبعات و MITES. ومن المثير للاهتمام ، هم وفيلاتوف وآخرون. (2009) وجد عنصرًا قابلًا للنقل (TE) وفيرًا على الجسيمات الذاتية المستبعدة على Y مما يشير إلى تطور متباين لتسلسل الحمض النووي على الجنس والكروموسومات الجسدية.

                                        كما لوحظ تراكم تسلسلات الحمض النووي المتكررة في الجنس رومكس، والتي تحتوي على العديد من الأنواع ذات الكروموسومات الجنسية ثنائية الشكل ونظام XX / XY1Y2 المعقد في R. أسيتوسا, R. papilaris و R. hastatulus (نافاجاس بيريز وآخرون.، 2006 ، 2009 انظر أيضًا الشكل 3 ب). ترافق انحطاط Y في نظام XX / XY1Y2 بتراكم هائل من الحمض النووي المتكرر متبوعًا بإعادة ترتيب الكروموسومات مما أدى إلى ظهور كروموسومات Y المتعددة (ماريوتي). وآخرون.، 2009 Navajas-Pérez وآخرون.، 2009). من شأن فقدان إعادة التركيب بين كروموسومات X و Y أن يقلل من المعدل التطوري لـ satDNAs الخاصة بـ Y ، ولكنه يعيق أيضًا عمليات التجانس الداخلية المحددة. نتيجة لذلك ، تم العثور على معدلات تطور مختلفة لمتغيرات الكروموسومات الجسدية والجنسية للتكرارات ، والأنماط التفاضلية لـ Y-heterochromatin بالإضافة إلى وجود عائلات فرعية مختلفة و satDNAs ذات الصلة في مناطق مختلفة من كروموسومات Y (ماريوتي) وآخرون.، 2009 Navajas-Pérez وآخرون.، 2006 ، 2009). علاوة على ذلك ، شهد كروموسوم Y العديد من الانقلابات بدرجات مختلفة.

                                        دليل إضافي على تكرار التراكم في أوقات مختلفة أثناء تطور كروموسومات Y ، يأتي من دراسات تكرار التسلسل البسيط الذي تراكم في كروموسوم Y لـ سيلين خاصة في الذراع الأطول الذي توقف عن إعادة الاتحاد مؤخرًا نسبيًا ولا يحتوي على أي تكرار آخر حتى الآن (Kejnovsky وآخرون.، 2009). في رومكس أسيتوسا تم العثور على العديد من التكرارات البسيطة للتسلسل بما في ذلك (ACC) (انظر الشكل 3 ب Karwur ، 2001) مضخمة بشكل كبير في كل من كروموسومات Y باستثناء تيلومير واحد ، يفترض المناطق الكاذبة. تُظهر الصبغيات والكروموسوم X مستويات أقل بكثير مع العديد من النطاقات المتميزة على طول معظم الكروموسومات المشابهة للنمط الموجود في كروموسومات القمح والجاودار (انظر الشكل 3 ج كوادرادو وشوارزاتشر ، 1998).


                                        الإجراءات التجريبية

                                        المواد الكيميائية الحيوية ، DNA البلازميد ، قليل النيوكليوتيدات ، السلالات البكتيرية ، والإنزيمات

                                        تم شراء المواد الكيميائية الدقيقة من GE Biosciences و Sigma وكانت جميع المواد الكيميائية المستخدمة من الدرجة التحليلية. تم الحصول على نوكليازات التقييد ، T4 DNA ligase ، T4 polynucleotide kinase و Pfu / Pfx polymerases من Thermo Scientific. [γ- 32 P] تم شراء ATP من Bhabha Atomic Research Centre ، مومباي ، أو Perkin Elmer. تم شراء أعمدة كروماتوغرافيا سائلة سريعة الأداء من GE Biosciences. تم شراء Oligonucleotides (ODN) من Sigma-Genosys ، سنغافورة أو MWG Biotech. بكتريا قولونية تم شراء سلالات DH5α و BL21-CodonPlus و Rosetta (DE3) pLysS والبلازميدات pET43.1.a (+) و pET21a (+) و pT7-7 من Novagen. الكوزميد MTCY227 الذي يحمل M. tuberculosis ruv المنطقة ، من معهد باستور ، فرنسا.

                                        تحليل لطخة غربية

                                        مرض السل تمت زراعة H37Ra عند 37 درجة مئوية في وسط Middlebrook 7H9 (ديفكو ، سباركس ، MD) المضاف إليه 0.2٪ جلسرين ، 10٪ ألبومين-دكستروز-كاتالاز ، و 0.05٪ توين 80 في حاضنة شاكر بسرعة 180 دورة في الدقيقة. تم تحضير محللات الخلية الكاملة كما هو موضح سابقًا (Thakur وآخرون، 2013). تحليل اللطخة الغربية لمحللات الخلية الكاملة من غير المعالجة مرض السل تم إجراء خلايا H37Ra باستخدام أجسام مضادة متعددة النسيلة أثيرت ضد MtRuvX كما هو موضح سابقًا (Sambrook وآخرون., 1989 ).

                                        العلاج بالأشعة فوق البنفسجية ورسائل الوسائط المتعددة

                                        مرض السل تمت زراعة H37Ra عند 37 درجة مئوية في وسط Middlebrook 7H9 (ديفكو ، سباركس ، MD) المضاف إليه 0.2٪ جلسرين ، 10٪ ألبومين-دكستروز-كاتالاز ، و 0.05٪ توين 80 في حاضنة اهتزاز بسرعة 180 دورة في الدقيقة. في أ600 نانومتر من 0.5 ، تمت إضافة MMS إلى تركيز نهائي قدره 0.04٪ واستمرت الحضانة عند 37 درجة مئوية. في موازاة ذلك ، تعرضت الخلايا لمصباح فلورسنت للأشعة فوق البنفسجية (UVITEC ، كامبريدج ، المملكة المتحدة) عند 180 جول / م 2 لمدة 6 دقائق. بعد التعرض ، تم تحضين الثقافات أثناء رجها برفق عند 37 درجة مئوية في الظلام. على فترات زمنية مختلفة ، تم حصاد الخلايا وغسلها بنسبة 10 ٪ توين 80 وتم تعليقها في محلول تحلل (20 ملي مولار تريس- HCl ، درجة الحموضة 7.5 ، 100 ملي كلوريد الصوديوم ، 10 ٪ جلسرين ، 2 ملي ميثان ميثان سلفونيل فلوريد).

                                        الوقت الحقيقي الكمي PCR

                                        تم إجراء تفاعلات qRT-PCR على غير المعالجة مرض السل خلايا H37Ra وتلك المعرضة للإشعاع فوق البنفسجي أو MMS. مرض السل تمت زراعة H37Ra كما هو موصوف أعلاه بخلايا محصودة تم غسلها بنسبة 10٪ توين 80 وتعليقها في وسط 7H9 جديد. تم تعليق كريات الخلايا في 5 مل من المخزن المؤقت للبروتوبلاست (15 ملي مولار Tris-HCl ، ودرجة الحموضة 8 ، و 0.45 مولار سكروز ، و 8 مم EDTA) مع 4 مجم مل من الليزوزيم وحضنت لمدة 45 دقيقة عند 37 درجة مئوية. تعرض معلق البروتوبلاست للطرد المركزي لمدة 10 دقائق عند 3000ز. تم عزل إجمالي الحمض النووي الريبي باستخدام مجموعة RNeasy (Qiagen). تبع ذلك توليف cDNA باستخدام Maxima First Strand cDNA Synthesis Kit (Thermo Scientific) مع 1 ميكروغرام من قالب RNA كما هو محدد من قبل الشركة المصنعة (ظروف Thermocycler: 25 درجة مئوية لمدة 10 دقائق 65 درجة مئوية لمدة 15 دقيقة وإنهاء رد فعل عند 85 درجة مئوية لمدة 5 دقائق). تم إجراء فحوصات PCR في الوقت الحقيقي باستخدام 200 نانوغرام من قالب (كدنا) ، 10 ميكرولتر من 2 × SYBR Green mastermix (Thermo Scientific) ، 1 ميكرولتر من البادئات الأمامية والعكسية (5 ميكرومتر لكل منهما) في جهاز StepOnePlus Real-Time PCR (مطبق النظم الحيوية). يدعم جدول المعلومات S1 تفاصيل أليغنوكليوتيدات المستخدمة في qRT-PCR. يتألف البرنامج المستخدم لـ PCR من 10 دقائق من التمسخ الأولي عند 95 درجة مئوية ، تليها 40 دورة من 95 درجة مئوية لمدة 15 ثانية ، والتلدين التمهيدي عند 60 درجة مئوية لمدة 30 ثانية ، والتمديد عند 72 درجة مئوية لمدة 30 ثانية تليها منحنى الانصهار.

                                        ركائز الحمض النووي

                                        تم سرد تسلسل قليل النيوكليوتيدات المستخدم في تحضير ركائز الحمض النووي المستخدمة في هذه الدراسة في جدول المعلومات الداعمة S2 و S3. تم تصنيف Oligonucleotides في نهاية 5 بواسطة [γ- 32 P] ATP و T4 polynucleotide kinase (Sambrook وآخرون. ، 1989). تم تحضير ركائز الحمض النووي عن طريق تلدين مجموعات مختلفة من قليل النوكليوتيدات (ODNs) ، كما هو موضح في جدول المعلومات الداعمة S3. لكل ركيزة ، تم تلدين كميات متكافئة من ODN المنقى في 100 ميكرولتر من 0.3 M سترات الصوديوم ، الرقم الهيدروجيني 7 ، 3 مولار كلوريد الصوديوم. تم تسخين مخاليط ODN لمدة 5 دقائق عند 95 درجة مئوية متبوعة بتبريد بطيء إلى 4 درجات مئوية على مدى ساعتين. تم فصل الركائز الملدنة بالكهرباء على هلام بولي أكريلاميد 12٪ (وزن / حجم) في محلول مؤقت تريس بورات 89 ملي مولار (درجة الحموضة 8.3) يحتوي على 1 ملي مولار EDTA. تم استئصال العصابات من الجل وتذويبها في محلول TE (10 ملي مولار Tris-HCl ، ودرجة الحموضة 7.5 ، 1 ملي مولار EDTA).

                                        بناء بلازميد مؤتلف يحمل جين M. tuberculosis ruvC

                                        تسلسل النوكليوتيدات لـ ruvc تم تحديد الجين (رقم الانضمام ، Rv2594c) باستخدام قاعدة بيانات TubercuList (//www.Pasteur.fr/Bio/TubercuList). تسلسل الترميز المقابل ل مرض السل H37Rv ruvc تم تضخيم الجين (Rv2594c) عبر PCR من cosmid MTCY 227 باستخدام مواقع تقييد 5′-ATG GGATCC GTGCGGGTGATGGGTGTC-3 ′ و 5′-ATG CTCGAG TCATCGGCGGCCTTCAG-3) التي تحمل مواقع تقييد BamHI و XhoI ، على التوالي. تم تنقية منتج PCR وهضمه باستخدام BamHI و XhoI وإدخاله في ناقل التعبير pET-43.1a (+) لإعطاء pMtRC.

                                        تنقية M. tuberculosis RuvC

                                        تم التعبير عن بروتين MtRuvC في بكتريا قولونية سلالة Rosetta (DE3) pLysS تؤوي pMtRC. نمت البكتيريا في مرق LB المضاف إليه المضادات الحيوية (100 ميكروغرام مل أمبيسيلين و 34 ميكروغرام مل كلورامفينيكول) عند 37 درجة مئوية حتى أ600 نانومتر بلغ 0.5. تم إحداث MtRuvC بإضافة 0.5 ملي مولار من IPTG وحضنت الثقافات بشكل أكبر أثناء اهتزازها برفق عند 18 درجة مئوية لمدة 12 ساعة. تم حصاد الخلايا عن طريق الطرد المركزي ، وغسلها في المخزن المؤقت STE (10 ملي مولار Tris-HCl ، ودرجة الحموضة 8 ، 100 ملي كلوريد الصوديوم ، 1 ملي مولار EDTA) ، أعيد تعليقها في المخزن المؤقت A (20 ملي مولار Tris-HCl ، درجة الحموضة 8 ، 50 ملي كلوريد الصوديوم ، 10٪ الجلسرين ، 5 مم 2-مركابتوإيثانول) وتخزينها عند -80 درجة مئوية. تم إذابة الخلايا ، صوتنة (نموذج رقم GEX-750 ، معالج فوق صوتي) وتم طرد المعلق في دوار Beckman Ti-45 عند 104350ز لمدة 1 ساعة عند 4 درجات مئوية. تم تطبيق محلول الخلية بالكامل على عمود Ni 2+ -NTA agarose الذي تمت معايرته مسبقًا باستخدام المخزن المؤقت A. تمت إزالة البروتينات المقيدة باستخدام تدرج خطي 50-500 ملي مولار من imidazole في المخزن المؤقت A. تم تجميع الأجزاء التي تحتوي على MtRuvC ودالتها ضد المخزن المؤقت B (20 مم Tris-HCl ، درجة الحموضة 7.5 ، 10٪ جلسرين) تحتوي على 50 ملي كلوريد الصوديوم. تمت إضافة Enterokinase (Sigma) إلى السائل المنحل والانقسام الذي تم إجراؤه عند 4 درجات مئوية لمدة 12 ساعة. تمت مراقبة إزالة علامة التقارب من البروتين بواسطة SDS-PAGE في أوقات مختلفة أثناء الحضانة. تم بعد ذلك تحميل البروتين المشقوق على عمود Ni 2+ -NTA agarose الذي تمت معايرته مسبقًا باستخدام المخزن المؤقت A. تم جمع التدفق من خلاله وغسيله مقابل المخزن المؤقت B الذي يحتوي على 1 M NaCl. تم تطبيق هذه العينة بعد ذلك على عمود ترشيح جل Sephadex 75 (Amersham Biosciences). تم تجميع الكسور التي تحتوي على MtRuvC المنقى ودالتها مقابل المخزن المؤقت للتخزين (20 ملي مولار Tris-HCl ، ودرجة الحموضة 8 ، 1 ملي مولار DTT ، 50 ملي كلوريد الصوديوم ، 50٪ جلسرين). تم تقييم نقاء MtRuvC بواسطة SDS-PAGE ، متبوعًا بتلوين Coomassie الأزرق. تم تحديد تركيز MtRuvC بواسطة طريقة ربط الصبغة باستخدام BSA كمعيار (Bradford ، 1976) وقسمات مخزنة عند -80 درجة مئوية.

                                        بناء بلازميد مؤتلف يحمل جين M. tuberculosis ruvX

                                        ال M. tuberculosis ruvX تم الحصول على تسلسل النوكليوتيدات من قاعدة بيانات TubercuList (//www.Pasteur.fr/Bio/TubercuList). تسلسل الترميز المقابل لـ مرض السل H37Rv ruvx تم تضخيم الجين (Rv2554c) بواسطة PCR من الحمض النووي الجيني باستخدام 5′-AAG GCTAGC GTGGTCCCAACACAGCAC-3 و 5′-GTC AAGCTT TCTGGCATCGGAGCCTTA-3 تحمل مواقع NheI و HindIII (تحتها خط) ، على التوالي. تم تنقية منتج PCR بهلام وهضمه باستخدام NheI و HindIII وإدخاله في pET21a (+) ناقلات التعبير. تم تعيين البلازميد الناتج pMtRX.

                                        بناء طفرات استبدال M. tuberculosis ruvX

                                        يتم سرد قليل النوكليوتيدات المستخدمة للطفرات الموجهة بالموقع في جدول المعلومات الداعمة S5. ال ruvx تم تحور جين pMtRX باستخدام طريقة QuikChange مع Pfu Turbo DNA polymerase و DpnI. تم استبدال حمض الأسبارتيك بالأسباراجين في الموضع 28 في تسلسل بروتين RuvX بالمثل ، تم استبدال السيستين مع الألانين في الموضع 38. بكتريا قولونية خدم DH5α كمضيف لتضخيم البلازميد. تم التحقق من الطفرات عن طريق تحليل التقييد وتسلسل الحمض النووي.

                                        الإفراط في التعبير وتنقية M. tuberculosis RuvX والمشتقات الطافرة

                                        تم التعبير عن بروتين MtRuvX في بكتريا قولونية سلالة Rosetta (DE3) pLysS تؤوي pMtRX. نمت البكتيريا في مرق LB المضاف إليه المضادات الحيوية (100 ميكروغرام مل أمبيسيلين و 34 ميكروغرام مل -1 كلورامفينيكول) عند 37 درجة مئوية حتى أ600 نانومتر من 0.5. تم إحداث MtRuvX بإضافة 0.5 ملي مولار من IPTG وتم تحضين الثقافات أثناء اهتزازها برفق عند 37 درجة مئوية لمدة 8 ساعات. تم جمع الخلايا عن طريق الطرد المركزي ، وغسلها في المخزن المؤقت STE ، وتعليقها في المخزن المؤقت A وتخزينها عند -80 درجة مئوية. تم إذابة الخلايا ، صوتنة ، وطرد المحللة بالطرد المركزي كما هو موصوف لـ MtRuvC. تم تطبيق محلول الخلية بالكامل على عمود SP-Sepharose تمت معايرته مسبقًا باستخدام المخزن المؤقت A والبروتينات المرتبطة بالتدرج الخطي 200-600 ملي مولار من NaCl في المخزن المؤقت A. تم تجميع الأجزاء التي تحتوي على MtRuvX ودالتها مقابل المخزن المؤقت B الذي يحتوي على 50 ملي كلوريد الصوديوم . تم بعد ذلك تحميل العينة على عمود هيبارين-أغاروز تمت معايرته مسبقًا باستخدام المخزن المؤقت B الذي يحتوي على 50 ملي مولار كلوريد الصوديوم. تمت التصفية من البروتينات المرتبطة باستخدام تدرج خطي 200-600 ملي مولار من كلوريد الصوديوم في المخزن المؤقت B. تم تجميع الكسور المحتوية على MtRuvX وترسبها بإضافة كبريتات الأمونيوم الصلبة إلى 60٪ تشبع. تم جمع البروتينات المترسبة بالطرد المركزي عند 10000ز لمدة 25 دقيقة عند 4 درجات مئوية.تم إعادة تعليق الحبيبات في المخزن المؤقت C (20 ملي مولار Tris-HCl ، ودرجة الحموضة 8 ، و 10٪ جلسرين) تحتوي على 1 مولار كلوريد الصوديوم و 5 ملي مركابتوإيثانول ، وتم غسلها مقابل نفس المخزن المؤقت. تعرضت هذه العينة لترشيح هلام من خلال عمود Superdex-75. تم تجميع الكسور التي تحتوي على MtRuvX ودالتها مقابل المخزن المؤقت للتخزين (20 ملي مولار Tris-HCl ، ودرجة الحموضة 8 ، 50 ملي كلوريد الصوديوم ، 50 ٪ جلسرين). تم تقييم نقاء MtRuvX بواسطة SDS-PAGE ، متبوعًا بتلوين Coomassie الأزرق وقسامات من MtRuvX المخزنة عند -80 درجة مئوية. مرض السل تم التعبير عن متغيرات RuvX ، MtRuvX D28N و MtRuvX C38A ، وتنقيتها كما هو موصوف لـ MtRuvX من النوع البري. تم تحديد تركيز بروتينات MtRuvX من النوع البري والمتحولة من خلال طريقة ربط الصبغة باستخدام BSA كمعيار (برادفورد ، 1976). تم إجراء تحليل الامتزاز بالليزر / التأين-زمن الرحلة (MALDI-TOF) بمساعدة المصفوفة باستخدام مطياف كتلة وقت الرحلة Bruker Biflex (Bruker Franzen ، بريمن ، ألمانيا) وفقًا لتوصيات الشركة الصانعة.

                                        استنساخ وإفراط في التعبير وتنقية الإشريكية القولونية YqgF

                                        تسلسل النوكليوتيدات بكتريا قولونية K-12 yqgF تم تضخيمه بواسطة PCR باستخدام Pfx polymerase من الحمض النووي الجيني باستخدام 5′-CAGGACACGCCATGAGTGGAACC-3 و 5′-CGCCAAGCTTTAAATCGCCTTAATATC-3 التي تحتوي على مواقع تقييد NdeI و BamHI. تم إدخال منتج PCR المهضوم في pT7-7 لتوليد pEcYF. تم الإفراط في التعبير عن EcYqgF من 2 لتر من خلايا BL21-CodonPlus التي تؤوي pEcYF في مرق LB المضاف إليه المضادات الحيوية (100 ميكروغرام مل أمبيسيلين و 34 ميكروغرام مل كلورامفينيكول) عند 37 درجة مئوية. تم إحداث تعبير EcYqgF في الخلايا عند مستوى أ650 نانومتر 0.5 بإضافة 1 ملي مولار من IPTG متبوعًا بالاهتزاز عند 37 درجة مئوية لمدة 3 ساعات أخرى. تم فصل الخلايا التي تم حصادها ، والمعلقة في 100 ملي Tris-HCl ، ودرجة الحموضة 8 ، و 2 ملي مولار EDTA ، و 5 ٪ من الجلسرين ، عن طريق الصوتنة ، وتم طرد المحللة عند 15000ز لمدة 20 دقيقة عند 4 درجات مئوية. تم خلط المادة الطافية مع 50 مل من السليلوز DEAE وتم تطوير العمود في المخزن المؤقت A مع التصفية من البروتينات المرتبطة في تدرج خطي من 0-1 M ملي بوكل كلوريد في المخزن أ. تم تطبيق الكسور المجمعة التي تحتوي على EcYqgF لاحقًا على 10 مل هيبارين-agarose ، 4 ml ssDNA السليلوز ، و 1.5 مل أعمدة فسفوسليلوز مع ظروف شطف مماثلة متبوعة بغسيل الكلى في ظروف منخفضة الملح بين كل خطوة كروماتوغرافيا. تم استعادة ما مجموعه 11 ملغ من EcYqgF المنقى وتخزينه في قسامات عند -80 درجة مئوية في مخزن مؤقت للتخزين.

                                        كروماتوغرافيا الترشيح الهلامي

                                        تم إجراء كروماتوجرافيا استبعاد الحجم التحليلي باستخدام عمود Superdex 200 10 / 300GL (GE Healthcare) بمعدل تدفق قدره 0.3 مل / دقيقة عند 18 درجة مئوية. تمت معايرة العمود مع محلول يحتوي على 20 ملي مولار من حمض الهيدروكلوريك ، ودرجة الحموضة 8 ، و 200 ملي مول كلوريد الصوديوم ، و 10٪ جلسرين. مجموعة من معايير البروتين للكتلة الجزيئية المعروفة مثل RNase A (13.7 كيلو دالتون) ، والأنهيدراز الكربوني (29 كيلو دالتون) ، والألبومين (43 كيلو دالتون) ، والكونالبومين (137 كيلو دالتون) ، والأبوفيريتين (480 كيلو دالتون) ، والديكستران الأزرق (2000 كيلو دالتون) لبناء المنحنى القياسي. تم غسيل 100 ميكرولتر من البروتين المنقى (1.2 مجم / مل) في محلول موازنة العمود وتمريره عبر العمود. تمت مراقبة الكسور بواسطة امتصاص الأشعة فوق البنفسجية عند 220 نانومتر. حجم الشطف (الخامسه) المطابق لقمة البروتين وتم حساب الوزن الجزيئي عن طريق الاستيفاء على المنحنى القياسي.

                                        فحوصات ربط الحمض النووي

                                        تحتوي مخاليط التفاعل (20 ميكرولتر) على 20 ملي مولار من Tris-HCl ، ودرجة الحموضة 8 ، و 100 ميكروغرام / مل من BSA ، و 0.3-0.5 نانومتر من الحمض النووي المسمى 5′-γ 32 P وزيادة تركيزات MtRuvC أو MtRuvX أو EcYqgF. تم تحضين مخاليط الربط عند 37 درجة مئوية لمدة 30 دقيقة (MtRuvC و MtRuvX) أو على الجليد لمدة 15 دقيقة (EcYqgF). بالنسبة إلى MtRuvC ، تم ربط التفاعلات عن طريق إضافة الجلوتارالدهيد إلى تركيز نهائي قدره 0.2٪ واحتضانها عند 37 درجة مئوية لمدة 10 دقائق ، تم إنهاء التفاعل بإضافة 2 ميكرولتر من صبغة التحميل (0.1٪ (وزن / حجم) من البروموفينول الأزرق والسيانول الزيلين في 20٪ الجلسرين). تم إخضاع العينات لفرز كهربائي من خلال 4 ٪ هلام بولي أكريلاميد في 0.25xTBE عازلة (6.7 ملي مولار تريس- HCl ، الرقم الهيدروجيني 8 ، 3.3 ملي أسيتات الصوديوم ، 2 ملي مولار EDTA) عند 75 فولت لمدة 4 ساعات عند 4 درجات مئوية. تم تجفيف الجل ، وتعريضه لشاشات تصوير فوسفوري وشرائط متصورة باستخدام Fuji FLA-9000 phosphorimager أو عن طريق التصوير الشعاعي الذاتي. تم قياس البيانات باستخدام محطة توثيق هلام UVItech مع برنامج UVI-BandMap (الإصدار 97.04) وتم رسمها باستخدام Graphpad Prism الإصدار 5. وأجري تحليل البيانات الإحصائية باستخدام معادلة الانحدار غير الخطي.

                                        فحوصات نشاط نوكلياز

                                        تحتوي مخاليط التفاعل النموذجية (20 ميكرولتر) على 20 ملي مولار Tris-HCl (الرقم الهيدروجيني 8.5) ، 100 ميكروغرام مل من BSA ، 10 ملي مولار MgCl2، و 0.3–0.5 نانومتر 5′-32 DNA المسمى P و MtRuvC ، MtRuvX أو EcYqgF بالتركيزات المحددة. تم تحضين مخاليط التفاعل عند 37 درجة مئوية لمدة ساعة وانتهت بإضافة 5 ميكرولتر من محلول التوقف (2.5٪ (وزن / حجم) SDS ، 200 ملي مولار EDTA ، 10 مجم / مل بروتيناز ك) ، تليها الحضانة لمدة 20 أخرى دقيقة عند 37 درجة مئوية. تم إخضاع العينات للرحلان الكهربي من خلال هلام بولي أكريلاميد بنسبة 8 ٪ في محلول TBE (90 ملي مولار من تريس بورات ، ودرجة الحموضة 8 ، 2 ملي مولار EDTA) عند 100 فولت لمدة 5 ساعات عند 4 درجات مئوية. تم تجفيف المواد الهلامية وتصويرها بواسطة التصوير الشعاعي الذاتي أو التصوير الفسفوري. تم قياس شدة النطاق كما هو موضح أعلاه.

                                        رسم خرائط مواقع الانقسام MtRuvX

                                        تم تحضين أربعة HJs ، كل منها على حدة 5 - 32 P المسمى على حبلا واحد مع MtRuvX في مخزن مؤقت يحتوي على 20 ملي مولار Tris-HCl ، ودرجة الحموضة 8.5 ، و 100 ميكروغرام مل −1 BSA و 10 ملي MgCl2 عند 37 درجة مئوية لمدة 1 ساعة. تم إنهاء التفاعلات بإضافة 5 ميكرولتر من محلول التوقف والحضانة عند 37 درجة مئوية لمدة 20 دقيقة. تم استخلاص العينات باستخدام الفينول / الكلوروفورم ، وتم ترسيب الحمض النووي بالإيثانول. تم إعادة تعليق الحبيبات التي تم الحصول عليها بعد الطرد المركزي في 5 ميكرولتر من المخزن المؤقت للتحميل المتسلسل [0.3٪ (وزن / حجم) أزرق بروموفينول ، 0.3٪ (وزن / حجم) زيلين سيانول ، 10 ملي مول EDTA ، درجة الحموضة 7.5 ، 97.5٪ فورماميد ] وتحريفها عن طريق الغليان لمدة 5 دقائق. تم تحليل العينات بواسطة الرحلان الكهربائي على بولي أكريلاميد 12٪-8 م يوريا جل عند 1200 فولت لمدة ساعتين (Sambrook وآخرون. ، 1989). تم تحميل سلالم التسلسل A + G لكل قليل النوكليوتيد المسمى ، الذي تم إنشاؤه باستخدام طريقة Maxam-Gilbert ، جنبًا إلى جنب لتوفير علامات. تم إجراء الرحلان الكهربي في محلول عازل تريس بورات 89 ملي مولار ، ودرجة الحموضة 8.3 ، و 1 ملي مولار EDTA عند 1800 فولت و 40 وات لمدة 3 ساعات. تم تجفيف المواد الهلامية وتحليلها بواسطة التصوير الفسفوري. تم تعيين مواقع الانقسام بالرجوع إلى سلم التسلسل. تم إجراء بدل أساسي 1.5 لتعويض النيوكليوسيد الذي تم التخلص منه في تفاعل التسلسل.

                                        التشابك الكيميائي لـ MtRuvX

                                        تم غسيل محلول MtRuvX المنقى (6 ميكرومتر) مقابل محلول يحتوي على 20 ملي مولار من حمض الهيدروكلوريك ، ودرجة الحموضة 8 و 10 ٪ من الجلسرين ، وتم معالجته بالكميات المحددة من الجلوتارالدهيد المخفف حديثًا. بعد الحضانة عند 37 درجة مئوية لمدة 30 دقيقة ، تمت إضافة 5 × محلول تحميل عينة SDS (10 ملي مولار Tris-HCl ، ودرجة الحموضة 6.8 ، و 40٪ جلسرين ، و 12.5٪ SDS ، و 25 ملي مولار DTT ، و 0.1٪ بروموفينول أزرق) وتم تمديد فترة الحضانة لمدة 5 دقيقة عند 95 درجة مئوية. تم تحليل العينات بنسبة 12.5٪ SDS-PAGE. تم تصور العصابات المتشابكة وغير المتقاطعة من خلال تلطيخ نترات الفضة.

                                        تصوير AFM

                                        تم تخفيف MtRuvX إلى تركيز 100 نانومتر في 20 ملي Tris-HCl ، ودرجة الحموضة 8 ، 2 ملي MgCl2. تم ترسيب قسامات (5 ميكرولتر) من خليط التفاعل على سطح الميكا المشقوق حديثًا وتم السماح لها بالالتصاق لمدة 5 دقائق. تم شطف سطح الميكا بسرعة بالماء منزوع الأيونات النانوي وتجفيف الهواء. تم الحصول على صور AFM في وضع التنصت باستخدام مسبار SNL (طرف السيليكون على ذراع النيتريد) (Agilent Technologies ، ثابت الربيع 21-98N / M). تم اشتقاق الكتل الجزيئية من الأحجام المقاسة كما هو موصوف (Edstrom وآخرون. ، 1990 يانغ وآخرون., 2003 ).

                                        تم حساب حجم الجزيئات باستخدام المعادلة: الخامسم = ح/6 (3ص 2 +ح 2) أين الخامسم هو الحجم الجزيئي ، و ص و ح هي نصف قطر وارتفاع البروتين على التوالي (شنايدر وآخرون آل، 1995). تم حساب الحجم الجزيئي النظري للبروتين باستخدام المعادلة: الخامسج = ما/نا (الخامس1 + دالخامس2)، أين ما هو الوزن الجزيئي ، نا هو رقم Avogadro و الخامس1 و الخامس2 هي الأحجام المحددة الجزئية للبروتين الفردي (0.74 و 1 سم 3 جم -1 ماء ، على التوالي) د هو مدى ترطيب البروتين (0.4 مول ماء / مول بروتين إيدستروم وآخرون., 1990 ).

                                        في المختبر أكسدة البروتينات

                                        تم إجراء الاختبار بشكل أساسي على النحو الموصوف (Oudot وآخرون. ، 1999 Indu وآخرون، 2010). احتوت مخاليط التفاعل على 20 ملي مولار من Tris-HCl ، ودرجة الحموضة 8 ، و 20 ملي كلوريد الصوديوم ، و MtRuvX (0.8 مجم مل) ، و 5 ملي مولار 1،10 فينانثرولين ، و 1.5 ملي مولار من كبريتات النحاس. بعد الحضانة عند 20 درجة مئوية لمدة 24 ساعة ، تم تقسيم العينة إلى جزئين ، تم تحضين الكسر الأول بـ 20 ملي ديثيوثريتول وتم الاحتفاظ بالجزء الثاني دون مزيد من المعالجة. تم خلط كلا الجزأين مع المخزن المؤقت لعينة SDS-PAGE (بدون 2-مركابتوإيثانول) وتم تسخينها عند 95 درجة مئوية لمدة 5 دقائق. تم تحليل العينات على صفحة غير مخفضة بنسبة 12.5٪ ونطاقات بروتينية متصورة باستخدام تلوين كوماسي الأزرق اللامع. تم اتباع نفس الإجراء لتحليل متحولة MTRuvX C38A.


                                        ملخص: تعتبر طريقة RRBS خيارًا رائعًا للباحثين الذين يريدون المزيد من تحليلات مثيلة الحمض النووي الخاصة بهم

                                        توجد تقنيات مختلفة لتحليل مثيلة الحمض النووي ، ولكل منها مزاياها الخاصة. يستخدم العديد من العلماء مصفوفات مثيلة Illumina DNA لتحليل 5-mC لأنها رخيصة الثمن. ومع ذلك ، فإن المصفوفات لا تسمح لك باكتشاف مواقع مثيلة الحمض النووي الجديدة التي قد تكون فريدة لنموذج مرضك المحدد أو نظامك التجريبي ، وهي غير متوافقة مع العينات غير البشرية ، لذلك فازت المصفوفات و rsquot بالعديد من الباحثين.

                                        يقدم RRBS مزايا مختلفة للنظر فيها. إلى جانب انخفاض كمية الحمض النووي اللازمة لبروتوكول RRBS والتوافق مع عينات FFPE ، يحلل RRBS أيضًا مستويات مثيلة الحمض النووي على مستوى الجينوم بأكمله بدقة زوج أساسي واحد ويغطي العديد من المواقع أكثر من صفائف Illumina.

                                        لذلك ، يستخدم الباحثون الذين يريدون المزيد من دراسات مثيلة الحمض النووي الخاصة بهم طرقًا تعتمد على NGS مثل RRBS و WGBS. كما أن انخفاض تكلفة تسلسل الحمض النووي يجعل النهج القائمة على التسلسل أكثر جاذبية. من المحتمل أن تمثل المقاربات المستندة إلى NGS على مستوى الجينوم للتحقيق في مثيلة الحمض النووي الطرق المستقبلية المختارة للباحثين ، وقد قام العديد من العلماء بالفعل بالتبديل.

                                        اتصل بنا إذا كنت مهتمًا بمعرفة المزيد عن RRBS ، أو كيفية عمل خدمتنا ، أو للحصول على عرض أسعار.

                                        نبذة عن الكاتب

                                        آن صوفي آي بيرثوميو ، دكتوراه.

                                        ولدت آن صوفي في جنوب فرنسا ونشأت بين البحر الأبيض المتوسط ​​وجبال البرانس. نشأت كمشجع للخيال العلمي ، مما دفعها إلى التخصص في البيولوجيا الجزيئية وعلم الوراثة أثناء دراستها العليا في جامعة ليون بفرنسا (على أمل أن يمنحها بحثها سراً قوى خارقة!). بعد أن عاشت في أماكن مختلفة للعمل ، عادت إلى ليون بفرنسا حيث تشارك زوجها وعائلتها وأصدقائها. خلال أوقات فراغها ، تتحدى آن صوفي نفسها بالمشي لمسافات طويلة وتسلق الجبال والسباق والسفر في بلدان أجنبية - بينما تنتظر نمو قواها الخارقة!

                                        اتصل بـ Anne-Sophie على LinkedIn لطرح أي أسئلة ، أو لإخبارها عن قواك الخارقة.

                                        ما هي اختراقات علم التخلق الحديثة المفضلة لديك؟ نحن نحب أن نسمع منك! يرجى الاتصال بنا على [email protected] أو Twitter (activemotif) لمشاركة أفكارك وملاحظاتك! نحن & rsquore أيضًا نبحث عن كتاب علميين للمساهمة في MOTIFvations ، لذلك إذا كنت & rsquore متواصلًا علميًا راسخًا أو كنت ترغب فقط في البدء ، يرجى التواصل & ndash قد تكون هناك قصة يمكننا التعاون فيها!


                                        شاهد الفيديو: حسابات البي سي ار الكمي qPCR gene expression in Arabic (قد 2022).


تعليقات:

  1. Orrick

    أعتذر ، لكن في رأيي أنت لست على حق. يمكنني إثبات ذلك. اكتب لي في PM.

  2. Thanatos

    في رأيي ، هم مخطئون. دعونا نحاول مناقشة هذا. اكتب لي في PM ، وتحدث.

  3. Kinris

    أوافق ، هذا الفكر ، بالمناسبة ، يسقط



اكتب رسالة