معلومة

أين صفيحة الغضروف في صورة المجهر الإلكتروني للقصبة الهوائية؟

أين صفيحة الغضروف في صورة المجهر الإلكتروني للقصبة الهوائية؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أيضا كيف يمكنك أن تقول؟ بافتراض أنه تم عرض صورة للغضروف فقط ، كيف يمكنك التعرف عليها؟


التحليل الكمي التصويري والتحليل النوعي المجسم لصور SEM

تتناول هذه الورقة طرق الحصول على معلومات ثلاثية الأبعاد من مسح صور المجهر الإلكتروني (SEM). قد يكون من المفاجئ أن هذا الموضوع يستحق مناقشة منفصلة ، لأنه من المقبول عمومًا أن كل صورة SEM لسطح خشن باستخدام وضع انبعاث الإلكترون الثانوي تعطي معلومات ثلاثية الأبعاد واضحة. هذا صحيح إلى حد ما ، نظرًا لأن صور SEM قابلة للمقارنة مع صور الأسطح الخشنة المضاءة بضوء قادم من اتجاه واحد ، ولكن اهتمامنا الرئيسي هنا سيكون مع التصور ثلاثي الأبعاد من أزواج الصور المجسمة. ومع ذلك ، هناك طرق أخرى يمكن من خلالها الحصول على المعلومات ثلاثية الأبعاد ، حتى في SEM ، ويتم اعتبارها أولاً. يهتم الجزء المتبقي من الورقة إلى حد كبير باستخدام الاختلافات المجسمة ، سواء تم تصورها على هذا النحو أم لا. يتم وصف الطرق الشائعة الاستخدام لعرض أزواج الاستريو ، تليها طرق بسيطة لقياس المنظر المجسم. تم تقديم صيغ لتقليل القياسات الخطية في الصورتين إلى فروق ارتفاع حقيقية.


علم الأجنة وأنسجة الرئة

تم إعداد هذا العرض لغرض فهم تطور الرئتين والأنسجة.

كتب ذات صلة

مجانًا مع إصدار تجريبي لمدة 30 يومًا من Scribd

الكتب المسموعة ذات الصلة

مجانًا مع إصدار تجريبي لمدة 30 يومًا من Scribd

ترتبط القصبات الهوائية والقصيبات عمومًا بالأوعية الدموية التي تتبع نفس بنية الشجرة المتفرعة. لاحظ الشرايين ، بما في ذلك الشريان الأصغر الموجود على يسار الشريان المسمى ، وكذلك الشريان الذي يمكن رؤيته يمر أسفل القصبات الهوائية في أسفل اليمين. ضع في اعتبارك أن الجدران الرقيقة التي تفصل الحويصلات الهوائية تتضمن شبكة من الشعيرات الدموية.

تم الاحتفاظ بالدم في الأوعية الدموية ، لذا فإن الوجود الواضح لخلايا الدم الحمراء يعمل على الكشف عن موقع الشعيرات الدموية السنخية.

يحتوي كل جدار سنخي على ظهارة حرشفية بسيطة تبطن كل سطح مكشوف ، مع سدى رفيع من الشعيرات الدموية ونسيج ضام داعم دقيق محصور بينهما. لا يمكن حل هذه التفاصيل بوضوح في هذه الصورة.
تمثل النوى المسطحة في الجدار السنخي إما الخلايا الرئوية من النوع الأول (الخلايا الحرشفية) أو البطانة الشعرية. قد تمثل النوى المستديرة خلايا رئوية من النوع الثاني (خلايا سنخية كبيرة تفرز الفاعل بالسطح).
يمكن أن تزحف الخلايا الوحيدة من الدم المنتشر خارج الشعيرات الدموية السنخية ، وعبور الظهارة السنخية ، ودخول الفضاء الجوي السنخي.


النتائج

إعداد الفئران المعدلة وراثيا

خط من الفئران المعدلة وراثيا مع أليل مستهدف ل Col11a2 (Liu et al. ، 1996) عن طريق إعادة التركيب المتماثل في الخلايا الجذعية الجنينية ، باستخدام بنية امتدت من 8 إلى 41 من Col11a2 الجين (الشكل 1). جين النيومايسين (الجدد) مدفوعًا بمحفز كيناز الفسفوجليسيرات في الاتجاه العكسي بين موقعي تقييد في exon 27 و 28 بحيث ينضم إلى متواليات من الإكسونات. تم تربية الفئران غير المتجانسة للأليل الفارغ لتوليد فئران متماثلة اللواقح كما هو موضح في تحليل اللطخة الجنوبية (الشكل 2 أ). أظهر تحليل اللطخة الشمالية لـ mRNA من الخلايا الغضروفية المعزولة من الغضروف الخنجري للفئران متماثلة اللواقح عدم وجود mRNA كامل الطول لـ Col11a2 (الشكل 2 ب). ومع ذلك ، تم تهجين نسختين قصيرتين على الأقل من RNA بحجم 4.2 كيلو بايت و 3.8 كيلو بايت باستخدام مسبار يحتوي على تسلسل exon 62 إلى exon 65 من Col11a2 الجين. لذلك ، يمكن أن يستمر النسخ من خلال الاختراع الجدد، لكن mRNA غير مستقر ، ربما بسبب تضمين المقلوب الجدد التسلسل داخل النصوص (Culbertson ، 1999). تم إجراء تفاعل سلسلة النسخ العكسي - البوليميراز (RT-PCR) على الحمض النووي الريبي الكلي من الغضروف المشاشية الفخذي باستخدام التمهيدي الأمامي الموجه إلى exon 23 والتمهيدي العكسي المستهدف إلى exon 29. أربعة نطاقات تتراوح في الحجم من 1.0 كيلو بايت إلى 1.4 كيلو بايت ، تم الحصول عليها بعد PCR بدلاً من نطاق واحد بالحجم المتوقع بحوالي 1.5 كيلو بايت. تم استنساخ جميع العصابات الأربعة وتسلسلها بالكامل. أظهرت النتائج أن الطرف 3′ من exon 26 تم تقطيعه باستمرار إلى نفس حد A / B الموجود 71-bp أسفل نهاية 3′ نهاية الجين المقاوم للنيومايسين (المسمى A في الشكل 3). ومع ذلك ، تم العثور على ثلاثة من النسخ الأربعة قد خضعت لربط داخلي إضافي للتسلسلات داخل الجين المقاوم للنيومايسين المعكوس (المعين باسم H2 و H3 و H4 الشكل 3). كانت جميع أحداث الربط موجودة بين ثنائي النوكليوتيدات الإجماعي GT / AG. احتوت جميع النصوص الأربعة على أكواد إنهاء مبكرة في جميع الإطارات الثلاثة إما في التسلسل المسمى G أو في تسلسل polylinker المصب. لذلك ، الترجمة غير قادرة على المضي قدما إلى ما بعد المقلوب الجدد إدراج. لم نعثر على أي دليل على أن الجدد يمكن تقطيع التسلسل بالكامل من النصوص أو لأحداث الربط الأخرى كما هو موضح سابقًا لـ الجدد متواليات (فورسبيرج وآخرون ، 1996).

تخطيطي للمنطقة ذات الصلة من Col11a2 الجين وناقل الاستهداف والمتحول Col11a2 الجين بعد إعادة التركيب المتماثل. امتد الجزء الجينومي لناقل الاستهداف من intron 8 إلى intron 41. TK ، جين الهربس البسيط thymidine kinase الجدد، الجين المقاوم للنيومايسين E و X و B ، مواقع تقييد ل سابقة بمعنى البيئةRI ، زهوالأرض بامأهلا.

أ: تحليل اللطخة الجنوبية لتحديد الفئران المعدلة وراثيا متغايرة الزيجوت ومتماثلة اللواقح. كان المسبار سابقة بمعنى البيئةجزء RI الذي امتد من intron 41 إلى intron 49 (انظر الشكل 1 والنص). ب: تحليل اللطخة الشمالية للحمض النووي الريبي الغضروفي من الفئران البرية ومتماثلة اللواقح. تم تشريح الغضروف الخنجري من الفئران وتم الحصول على الخلايا الغضروفية عن طريق الهضم الأنزيمي للأنسجة. تم استخراج مجموع الحمض النووي الريبي وتحليله عن طريق تحليل اللطخة الشمالية باستخدام أ هينdIII /بامHI [كدنا] جزء ترميز exons 62 إلى 65.

التمثيل التخطيطي للنتائج التي تم الحصول عليها عن طريق تفاعل البوليميراز المتسلسل العكسي للنسخة العكسية على الرنا المرسال للغضروف من الفئران المتماثلة اللواقح باستخدام البادئات الموجودة في exons 23 و 29. تم الكشف عن أربعة نطاقات من 1.0 إلى 1.4 كيلو بايت ، وتم استنساخ كل هذه النطاقات وتسلسلها. في جميع نسخ Col11a2 من الفئران المتماثلة اللواقح ، تم العثور على الطرف 3′ من exon 26 مقسمًا إلى موقع متقبل ما يقرب من 71 نيوكليوتيدًا في نهاية الطرف الثالث من الجين المقاوم للنيومايسين المعكوس (المعين H1 – H4) . في ثلاثة من النصوص ، كان هناك أيضًا تضفير داخلي لتسلسل تشفير الجين المقاوم للنيوميسين المقلوب (H2 و H3 و H4).

للتأكد من أن Col11a2 تم تعطيل الأليل ، وتم تشريح الغضروف الضلع من فئران من النوع البري ومتجانسة الزيجوت عمرها شهر واحد ، وتم هضم الأنسجة بالبيبسين وفحصت المكونات الكولاجينية عن طريق الرحلان الكهربائي لهلام دوديسيل كبريتات الصوديوم (SDS-PAGE) لوجود اكتب الكولاجين الحادي عشر. كما هو مبين في الشكل 4 ، كان الممر B أو سلسلة α1 (XI) أو α1 (V) من الكولاجين من النوع V / XI لا يزال موجودًا. ومع ذلك ، فإن سلسلة α2 (XI) كانت غائبة. لم يتم فصل سلسلة α3 (XI) عن سلسلة α1 (II) الوفيرة التي يبدو أنها تم تصنيعها بكميات طبيعية.

الرحلان الكهربائي لجيل دوديسيل كبريتات الصوديوم-بولي أكريلاميد للكولاجين المقاوم للبيبسين من الغضروف الضلع من النوع البري البالغ من العمر شهرًا واحدًا (اليسار) والفئران متماثلة اللواقح (حق). تم تطبيق كميات متساوية من العينة على الجل. تم تصور عصابات البروتين بواسطة تلطيخ Coomassie الأزرق لتحديد سلاسل α من النوع الثاني ونوع الكولاجين الحادي عشر. لا يمكن اكتشاف نطاق من سلسلة α2 (XI) في مستخلص الضلع متماثل اللواقح.

النمط الظاهري للفئران

كان لا يمكن تمييز الفئران متغايرة الزيجوت عند الولادة عن زملائها العاديين. كانت الفئران متجانسة الزيجوت أصغر بنسبة 25٪ تقريبًا من زملائها العاديين (8.51 جم ± 1.87 SD [n = 14] مقابل 11.1 جم ± 0.85 SD [n = 6] ص = 0.005). كانت الفئران متجانسة الزيجوت يمكن التعرف عليها أيضًا من زملائها في مجموعة الزيجوت غير المتجانسة من حيث أن لديهم أنف أقصر وجبهة منتفخة قليلاً (الشكل 5 أ). استمروا في أن يكونوا أصغر حجمًا من الجسم حتى عمر عامين ويمكن التعرف عليهم بسهولة من خلال وجوههم الأكثر مثلثة. كانت هذه السمات المميزة أكثر وضوحا في الهياكل العظمية الملطخة (الشكل 5 ب). ومع ذلك ، لم يكن أي من أكثر من 200 فأر حديث الولادة متجانسة الزيجوت التي تم فحصها مصابًا بالحنك المشقوق كما هو شائع في مرضى OSMED (Melkoniemi et al. ، 2000). عندما تم فحص الفئران متماثلة اللواقح في عمر 4 أشهر ، لم تستجب للضوضاء العالية ، وهي ملاحظة تشير إلى أنها تعاني من نقص في السمع. في وقت لاحق ، أكد اختبار استجابة جذع الدماغ السمعي الناتج عن النقر على ذلك ، ويبدو أن الأساس الهيكلي للنقص نشأ من ألياف الكولاجين غير المنتظمة للغشاء القصبي (McGuirt et al. ، 1999). لم يكن هناك تشوهات جسيمة واضحة في العين أو الأعضاء الرئيسية الأخرى.

أ: صور فئران عادية ومتماثلة اللواقح لإظهار اختلافات الوجه. ب: هياكل عظمية ملطخة من النوع البري حديثي الولادة (+ / +) ، متغاير الزيجوت (+/-) والفئران متماثلة اللواقح (- / -). لاحظ اختلافات الوجه في الفأر متماثل اللواقح. ج: ظهور جماجم الفئران البرية ومتماثلة اللواقح. لاحظ الانحدار الحاد للجمجمة والمسافات البادئة في عظام الأنف (السهم) في الماوس متماثل اللواقح. د: مقارنة نسب الطول إلى العرض للعظام على الجوانب الظهرية للجماجم من فئران من النوع البري عمرها عام واحد (+ / +) وفئران متماثلة اللواقح (- / -). تمثل كل نقطة بيانات متوسط ​​± SEM من سبع جماجم. العظام مرتبة بترتيب خلفي (INT) إلى أمامي (NAS). الفرق في نسبة عظم الأنف كبير في ص ≤ 0.001 وينشأ من أقصر طول للعظم في جمجمة الزيجوت المتماثلة الزيجوت. INT ، العظم بين الجداري ، PAR ، العظم الجداري FRO ، العظم الجبهي PRE ، premaxillae NAS ، عظم الأنف.

مورفولوجيا القحف الوجهي

كشفت الملاحظة التشريحية الإجمالية للجماجم من الفئران البالغة من العمر سنة واحدة أن عظام أنف الفئران متماثلة اللواقح كانت أكثر انحدارًا وأن أسطحها الإنسي غالبًا ما كانت منخفضة (سهم الشكل 5C). وهكذا ، في الموقع ، أنتجت عظمتا الأنف المتجاورتان انخفاضًا ملحوظًا. أظهرت نسب الطول إلى العرض للعظم الأنفي للفئران المتماثلة اللواقح فرقًا كبيرًا عند مقارنتها بالنوع البري ، لكن عظام الجمجمة الأخرى (العظام بين الجدارية والجدارية والجبهة والفكين) لم تتأثر بشكل كبير (الشكل 5 د).

في المقاطع الإكليلية لجمجمة الفئران البالغة من العمر سنة واحدة ، كان الاختلاف في المسافة البادئة وشكل عظام الأنف واضحًا (الشكل 6 أ ، ج). في المقاطع الإكليلية للولدان متماثل الزيجوت (الشكل 6 د) ، تم تجويف عظام الأنف بعمق باتجاه الغضروف على شكل Y الناتج عن نمو الحاجز الأنفي خاصة عند مقارنتها بأقسام من الفئران من النوع البري (الشكل 6 ب). يتطور عظم الأنف عن طريق التعظم الغشائي ، لكن شكله يتحدد بواسطة الغضروف المجاور (الشكل 6 ب ، د). لذلك ، يمكن تفسير الاختلافات في الطول ، والانحدار ، والمسافة البادئة لعظم الأنف في الفئران متماثلة اللواقح من خلال الاختلافات في شكل الغضروف ، والذي يعمل كقالب لتشكيل عظام الأنف (الشكل 6 ب ، د).

أ ، ج: القسم التاجي من الجمجمة الأمامية للفئران البرية ومتماثلة اللواقح عند عمر سنة واحدة. يظهر انخفاض واضح يتكون من عظمتي الأنف (N) في الفأر متماثل الزيجوت ، بينما يظهر عظم بريماكسيلا (P) غير متأثر. ب ، د: التطور في الفئران حديثي الولادة لعظام الأنف (N) حيث يعمل غضروف الحاجز (S) كقالب. لاحظ أن عظام الأنف تظهر بشكل أقل شأناً في الفأر متماثل اللواقح. NA، تجويف الأنف.

مورفولوجيا العظام الطويلة

تم تحضير المقاطع المضمنة بالبارافين من مفاصل الركبة من الفئران البرية ومتماثلة اللواقح في شهر واحد بعد الولادة. أظهر فحص هذه الأقسام لوحة نمو غير منظمة بشدة في الزيجوت المتماثل مع فشل الخلايا الغضروفية في المحاذاة في الأعمدة (الشكل 7 ب ، د). تم العثور على نتائج مماثلة لجميع لوحات النمو الأخرى التي تم فحصها. في النوع البري ، تم تنظيم لوحات النمو جيدًا مع محاذاة الخلايا الغضروفية في أعمدة طولية بحيث يمكن التعرف بسهولة على مناطق الراحة الفردية والمتكاثرة والمتضخمة (الشكل 7 أ ، ج). في المقابل ، بدت صفيحة النمو للفئران متماثلة اللواقح التي تفتقر إلى α2 (XI) غير منظمة تمامًا ، وعند الفحص الدقيق ، ظهرت نوى بعض الخلايا الغضروفية. ومع ذلك ، يمكن غالبًا ملاحظة الخلايا الغضروفية الضخامية أسفل الطبقة المتكاثرة مباشرة ، مما يشير إلى أن التمايز النهائي للخلايا الغضروفية كان قادرًا على المضي قدمًا بشكل طبيعي. كان الغضروف المفصلي الظنبوبي في المتوسط ​​أرق من النوع البري (قارن الشكل 7E ، F). لوحظ نفس الشيء بالنسبة لجميع الغضاريف المفصلية عند عمر شهر واحد (انظر الشكل 9). بالإضافة إلى ذلك ، كانت الخلايا الغضروفية للغضروف المفصلي للفئران متماثلة اللواقح أكثر تنظيمًا بشكل عشوائي (قارن الشكل 7E و 7 F). أظهر الفحص المجهري الإلكتروني للإرسال لصفيحة النمو وجود ألياف كولاجين دقيقة في كثير من الأحيان محاذاة بين أعمدة الخلايا في كل من الفئران المعدلة وراثيًا من النوع البري ومتماثلة اللواقح (الشكل 8 أ ، ب). غالبًا ما ظهرت ألياف الكولاجين في الفأر متماثل الزيجوت أقل تنظيمًا في المصفوفات الجانبية مقارنة بالفأر من النوع البري كما لوحظ سابقًا في الغشاء الصدري (McGuirt et al. ، 1999). في بعض مناطق المنطقة التكاثرية ، أصبحت الألياف مرتبطة ارتباطًا وثيقًا ببعضها البعض وشكلت حزمًا كثيفة الإلكترون (الشكل 8C). ومع ذلك ، فإن تكوين مجاميع كبيرة من الكولاجين الليفي كما هو موصوف لـ هنود الحمر لم يحدث الفأر (Li et al. ، 1995).

التحليل النسيجي لمشاش الظنبوب قبل شهر من الولادة من النوع البري (أجاد) والفئران متماثلة اللواقح (ب ، د ، واو). في الفأر من النوع البري (+ / +) ، تحتوي لوحة النمو جيدة التنظيم على طبقات مريحة ومنتشرة ومتضخمة. في الفأر المتماثل (- / -) ، تفشل أعمدة الخلايا الغضروفية في المحاذاة بشكل صحيح وتظهر الخلايا غير منظمة غالبًا ما تشكل مجموعات عشوائية. E و F: لاحظ الاختلاف في تنظيم الخلايا الغضروفية في الغضروف المفصلي. يشكل النوع البري مصفوفة جيدة التنظيم ، بينما في الحيوان متماثل اللواقح ، يكون الغضروف المفصلي أرق وتظهر الخلايا غير منظمة بشكل طفيف. أشرطة المقياس = 125 ميكرومتر في B (ينطبق على A ، B) ، 50 ميكرومتر في D (ينطبق على C ، D) ، 25 ميكرومتر في E (ينطبق على E ، F).

المجهر الإلكتروني للإرسال لصفيحة نمو الفخذ (شهر واحد بعد الولادة) من النوع البري (+ / +) (أ) والفأرة المعدلة وراثيا متماثلة اللواقح (- / -) (قبل الميلاد). يُظهر A و B مناطق قابلة للمقارنة تقع في المنطقة التكاثرية لصفيحة النمو بين عمودين من الخلايا الغضروفية. لاحظ المحاذاة المتوازية للألياف في A والألياف الأقل ترتيبًا قليلاً في B. C هي منطقة تمثيلية للمنطقة التكاثرية حيث تكون الخلايا الغضروفية غير منظمة للغاية. لاحظ أن الألياف غالبًا ما ترتبط ارتباطًا وثيقًا بشكل جانبي لتشكيل حزم كثيفة الإلكترون. أشرطة المقياس = 500 نانومتر

قمنا أيضًا بفحص أقسام من فخذ الفئران في 15.5 يومًا ، و 17.5 يومًا ، وحديثي الولادة ، وبعد أسبوع واحد ، وأسبوعين ، و 4 أسابيع بعد الولادة. قبل تكوين صفيحة نمو مميزة ، لا تتماشى الخلايا الغضروفية في الأعمدة ولم تكن غير منظمة بشكل ملحوظ عند مقارنة النوع البري والبيض المتماثل. ومع ذلك ، في 1 و 2 و 4 أسابيع بعد الولادة ، أصبح عدم تنظيم الخلايا الغضروفية أكثر وضوحًا وكان أكثر وضوحًا بعد تشكل لوحة النمو بالكامل في 4 أسابيع (لم يتم تقديم النتائج). داخل أحد الأطراف ، أظهرت جميع لوحات النمو عدم تنظيم مماثل في متماثلة الزيجوت. لذلك ، يبدو أن سلسلة α2 (XI) مطلوبة للتنظيم الصحيح لألياف الكولاجين لكل لوحة نمو ، ولكنها قد لا تلعب دورًا مهمًا في المراحل المبكرة من تكوين الغضروف.

لتقييم تمايز الخلايا الغضروفية ، أجرينا تهجينًا في الموقع على قصبة الوليد من أجل Col1a1, Col2a1, Col10a1, Col11a1، و Col5a1. أظهرت جميع المسابير التي تم فحصها لجينات الكولاجين هذه أنماط التعبير نفسها في الظنبوب للفئران البرية أو متماثلة الزيجوت ، حيث يتم التعبير عن سلسلة الكولاجين α1 (V) في العظام النامية وطوق العظام وليس في الغضروف (الشكل 9H ، ي). تم التعبير عن الكولاجين من النوع X فقط في الغضروف الضخامي (الشكل 9C ، F). بالإضافة إلى ذلك ، أجرينا تلطيخًا كيميائيًا مناعيًا بأجسام مضادة ضد الكولاجين من النوع الثاني والنوع X الكولاجين. تم اكتشاف الكولاجين من النوع الثاني في جميع أنحاء المنطقة الغضروفية لصفيحة النمو ، ولكن تم اكتشاف النوع X من الكولاجين فقط في الطبقة الضخامية في كل من الفئران البرية ومتماثلة اللواقح (لم يتم تقديم البيانات). وهكذا ، على الرغم من أن صفيحة النمو غير منظمة بشكل ملحوظ ، إلا أن الخلايا الغضروفية ، مع ذلك ، تتقدم نحو التضخم.

التهجين في الموقع للعديد من mRNAs الكولاجين في لوحة نمو قصبة الساق. Col1a1 (ميلادي) و Col5a1 (ح ، ي) فقط في الترقوة والعظام النامية. Col2a1 (يكون) و Col11a1 (جي ، أنا) في كل من طبقات الراحة والتكاثر للغضروف النامي ولكن ليس في الغضروف الضخامي. Col10a1 (ج ، واو) فقط في الخلايا الغضروفية الضخامية. لا يمكن التعرف على أي اختلاف في أنماط التعبير عن الرنا المرسال الكولاجين الخمسة في كل من الفئران من النوع البري والفئران متماثلة اللواقح. أشرطة المقياس = 250 ميكرومتر في F (ينطبق على A – F) ، في J (ينطبق على G – J).

الغضروف المفصلي

قمنا بقياس سمك المشاش من عدة عظام طويلة ، لأن الملاحظات الأولية تشير إلى أنها كانت أرق في الزيجوت متماثلة الزيجوت (قارن الشكل 7E و 7 F). كانت جميع الغضاريف المفصلية التي تم فحصها (عظم الفخذ الداني والبعيدة ، الحُق ، العضد القريب والبعيدة ، الحفرة الحقانية ، الزند القريب ، ونصف القطر القريب) أرق بشكل ملحوظ في المتوسط ​​بعد شهر واحد من الولادة في الفئران متماثلة اللواقح (الشكل 10). لم تكن هناك أي علامة على تآكل كبير في الأسطح المفصلية في الفئران من النوع البري أو الفئران متماثلة اللواقح. ومع ذلك ، يمكن تمييز الغضروف المفصلي للفئران متماثلة اللواقح غالبًا عن طريق فشل الخلايا الغضروفية في المحاذاة بطريقة عمودية (الشكل 7E ، F). بالإضافة إلى ذلك ، غالبًا ما يكون للخلايا الغضروفية المتماثلة الزيجوت أشكالًا مشوهة. تم فحص المفاصل حتى عمر عام واحد ، ولكن لم يتم العثور على دليل على زيادة التهاب المفاصل في الزيجوت متماثلة الزيجوت مقارنة بالنوع البري ، وهذا يتفق مع دراسة سابقة (Lapveteläinen et al. ، 2001).

مقارنة سمك الغضاريف المفصلية في فئران عمرها شهر واحد. كانت جميع الغضاريف المفصلية من الفئران المتجانسة (- / -) أرق من المفاصل من النوع البري (+ / +). متوسط ​​السماكة ± SD للغضاريف المفصلية عند خمسة مفاصل ركبة ومفصلي ورك وخمسة مفاصل كتف وثلاثة مفاصل كوع لأربعة أزواج من الفئران من النوع البري (+ / +) وفئران متماثلة اللواقح (- / -). تمثل نقاط البيانات من 14 إلى 70 قياسًا لكل مفصل ليصبح المجموع 420. في مفصل الكتف ، لم يكن سمك الغضروف مختلفًا بشكل كبير عند الحفرة الحقانية (SG) ، وكان مهمًا فقط عند مستوى 90٪ (ص = 0.10) على السطح المفصلي العضدي (SH). KF ، مفصل الركبة ، عظم الفخذ HF ، مفصل الورك ، عظم الفخذ HA ، مفصل الورك ، الحُق SH ، مفصل الكتف ، عظم العضد SG ، مفصل الكتف ، حقاني الحفرة EH ، مفصل الكوع ، عظم العضد ، مفصل الكوع ، عظم الزند ، مفصل الكوع ، نصف القطر


الجوانب البيولوجية للغضاريف النسيجية

تطور الطب التجديدي للغضروف بشكل جيد ، ووصل إلى مرحلة التطبيق السريري. من بين التقنيات المختلفة ، يتم التحقيق بجدية في هندسة الأنسجة ، والتي تتضمن عناصر من علم المواد ، مدفوعة بالاحتياجات السريرية العالية. تم استخدام هندسة أنسجة الغضروف باستخدام سقالة بولي لاكتيد بشكل استكشافي في علاج مرضى الأنف المشقوقة ، مما يكشف عن نتائج سريرية جيدة خلال مراقبة لمدة 3 سنوات. ومع ذلك ، لزيادة موثوقية هذا العلاج ، ليس فقط تراكم الأدلة السريرية على سلامة وفائدة المنتجات المهندسة الأنسجة ، ولكن أيضًا إنشاء خلفية علمية حول الآليات البيولوجية ، تعتبر ضرورية. في هذه الورقة ، استعرضنا الاتجاهات الحديثة لهندسة أنسجة الغضاريف في الممارسة السريرية ، ولخصنا النتائج التجريبية على التغيرات الخلوية والمصفوفة أثناء تجديد الغضروف ، وناقشنا أهمية إجراء مزيد من الدراسات حول الجوانب البيولوجية للغضاريف المهندسة للأنسجة ، خاصةً من قبل النسيج النسيجي و الطرق المورفولوجية.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


مقدمة

منذ ذلك الحين ، تم تحديد فهمنا للتنظيم الهيكلي التفصيلي للمواد البيولوجية بشكل أساسي من خلال التقنيات المجهرية. بدءًا من الفحص المجهري الضوئي في القرن الثامن عشر وبلغت ذروتها في تطوير المجاهر الإلكترونية في القرن العشرين ، تطورت الأنسجة نفسها جنبًا إلى جنب مع تحسين التقنيات المجهرية. اليوم ، فإن عددًا كبيرًا من معرفتنا بالبنية التحتية للكائنات والأنسجة والخلايا مشتق في الغالب من طرق مجهرية إلكترونية مختلفة مثل النقل أو المسح المجهري الإلكتروني.

منذ إدخال المجهر الإلكتروني (EM) ، تم إنشاء عدد كبير من تقنيات تحضير العينات للحصول على عينة EM مناسبة 1 & # x02013 5. ومع ذلك ، لا تزال البروتوكولات المطبقة بشكل شائع معقدة للغاية اليوم ، حيث تستخدم مواد كيميائية سامة وتؤدي إلى عينات مناسبة بشكل أساسي للفحص المجهري الإلكتروني ، باستثناء التقنيات الأخرى وارتباطها ببيانات EM منذ البداية. بالإضافة إلى ذلك ، يتم إعاقة تحقيقات الوسم المناعي المهمة للغاية بسبب العديد من الصعوبات الناشئة عن العلاج المكثف للعينة قبل الحصول على بيانات EM ، خاصةً من التضمين في راتنجات الإيبوكسي 6 ، 7. إجمالاً ، تعاني EM من بعض القيود الحرجة التي تخلق عقبات رئيسية تتعلق بمجموعة متنوعة من التجارب على العينات البيولوجية.

مع إدخال مجهر القوة الذرية (AFM) بواسطة Binnig و Quate و Gerber في عام 1986 8 ، أصبح نهجًا مجهريًا جديدًا متاحًا يتضمن بعض المزايا المذهلة على تقنيات البنية التحتية التقليدية. مع AFM ، لم تعد هناك حاجة لتطبيق الفراغ على العينة من أجل إنشاء معلومات التصوير ، وبالتالي أصبح من الممكن أخيرًا الحصول على بيانات البنية التحتية للمواد البيولوجية في ظل الظروف الفسيولوجية 9 ، 10. بالإضافة إلى ذلك ، تم تقليل الحاجة إلى تقنيات تحضير العينات المكثفة بشكل كبير مقارنة بإلكترون الإرسال أو الفحص المجهري الإلكتروني (TEM ، SEM). تشمل المزايا الأخرى لـ AFM على EM على سبيل المثال القدرة على تحليل بيانات المحور z بدقة وكذلك القدرة على الوصول إلى خصائص المرونة اللزجة لعينة عن طريق التحليل الطيفي للقوة.

إلى جانب المزايا المذكورة لـ AFM على EM ، لا يزال أحد القيود المذهلة يسبب مشاكل كبيرة في الحصول على بيانات البنية التحتية للسمات الداخلية للعينات البيولوجية في الماضي. كأسلوب طوبوغرافي ، يحتاج AFM إلى إنشاء تفاعلات مباشرة بين مسبار القياس وهيكل الاهتمام من أجل إنشاء معلومات التصوير. إن اكتساب نظرة ثاقبة على التشكل الداخلي للكائنات الحية والأنسجة والخلايا المفردة بواسطة AFM كان عقبة شائعة بين الباحثين في AFM.

إن التغلب على المشكلة المذكورة يعد بالقدرات المتعلقة بالحصول على بيانات البنية التحتية للعينات البيولوجية بواسطة AFM مقارنة بـ EM ، على سبيل المثال خيار الوصول إلى بيانات المحور z الدقيقة بالإضافة إلى خصائص المرونة اللزجة لعينة معينة فقط على سبيل المثال لا الحصر.

من أجل تمكين AFM للسمات الداخلية للمواد البيولوجية ، تم تطوير بروتوكول سهل الاستخدام وقابل للتطبيق على نطاق واسع من البولي إيثيلين جليكول ، والتقسيم الفائق والجفاف ، مما أدى إلى القدرة على تحديد البنية التحتية للتشكيل الداخلي لأي مادة بيولوجية تقريبًا بواسطة AFM. في البداية ، تم إصلاح العينات التي تم فحصها في الدراسة الحالية باستخدام كواشف نموذجية مثل الجلوتارالدهيد أو بارافورمالدهيد. ثانيًا ، تم إجراء تجفيف العينة عن طريق تطبيق سلسلة تخفيف الماء / الإيثانول ، متبوعًا بالتسريب من البولي إيثيلين جلايكول (PEG) كوسيط تضمين. بعد تجميد الكتلة والتقسيم الفائق على مشراح فائق نموذجي مجهز بسكاكين زجاجية قياسية ، تم تجميد المقاطع التي تم الحصول عليها على شرائح زجاجية مطلية وتمت إزالة وسط التضمين القابل للذوبان في الماء تمامًا عن طريق خطوات الغسيل المتكررة. أخيرًا ، تم تجفيف العينات باستخدام تقنية تدفق هواء بسيطة وتم تصويرها لاحقًا بواسطة وضع التلامس المتقطع AFM في ظل الظروف المحيطة.

بهدف عدم استبعاد العلماء غير القادرين على الوصول إلى أحدث تقنيات AFM ، تم استخدام أدوات AFM المتاحة بشكل شائع (وضع الاتصال المتقطع في الهواء) على وجه التحديد في التحقيقات المقدمة. تهدف الدراسة الحالية إلى توضيح إمكانية تطبيق البروتوكول المذكور على عينات بيولوجية تمثيلية مختارة ، من أجل إثبات جدواها على أي كائن حي أو نسيج أو خلية تقريبًا.


المواد والأساليب

تحضير وتوصيف أنسجة الغضاريف الأصلية

تحضير أنسجة الغضروف الأصلية

تم قطع أنسجة الغضروف المفصلي من مفاصل الركبة لأرانب نيوزيلندية عمرها 3 و 100 و 200 يوم (مزرعة تربية للجنة الخاصة للحيوانات التجريبية في مقاطعة سيتشوان) مباشرة بعد القتل الرحيم. تم حصاد شرائح الغضروف بشفرة حلاقة وغسلها ببرنامج تلفزيوني.

محتوى الماء

لقياس الوزن الرطب (WW) لأنسجة الغضروف ، تمت إزالة الرطوبة الزائدة على سطح الأنسجة أولاً باستخدام ورق الترشيح ، قبل وضعها على ميزان إلكتروني (ME204) لتسجيل WW. تم بعد ذلك تجفيف نسيج الغضروف نفسه عند 70 درجة مئوية لمدة 72 ساعة ، وتم قياس الوزن الجاف وفقًا لذلك. تم حساب المحتوى المائي لأنسجة الغضاريف الأصلية من الأرانب حديثي الولادة أو الأحداث أو البالغين على النحو (WW - الوزن الجاف) / WW * 100٪.

التقييم الميكانيكي

تم تحديد التقييم الميكانيكي لكل عينة باستخدام nano-indenter (Piuma ، Optics11 ، The Netherlands). تم حساب المعامل الفعال للشباب من خلال البيانات الملائمة للمعلمات التالية: صلابة المسبار 4.3 (N · m −1) نصف قطر طرف 51.0 ميكرومتر.

الكمي للحمض النووي

تم تحقيق تقدير كمية الحمض النووي باستخدام مجموعة مقايسة Quant-iT TM Picogreen TM dsDNA. باختصار ، تم هضم جزيئات الغضروف في محلول غراء (0.1 مجم / مل) عند 65 درجة مئوية لمدة 24 ساعة قبل الاختبارات. تم تخفيف 100 ميكرولتر من عصير غراء الهضم مع TE (1 ×) ثم خلطها مع سائل عمل Picogreen. بعد الحضانة في الظلام لمدة 3-5 دقائق ، تم قياس الخليط عن طريق قياس التألق وفقًا لبروتوكول الشركة المصنعة.

الكمي من sGAG والكولاجين الكلي

تم تحديد محتوى sGAG باستخدام مجموعة اختبار Blyscan GAG (Biocolor ، Newtownabbey ، المملكة المتحدة). باختصار ، تم خلط 10 ميكرولتر من المادة الطافية مع كاشف صبغة بليكان. بعد الطرد المركزي ، تم إذابة مركب صبغة sGAG في كاشف التفكك متبوعًا بقياس الامتصاصية عند 656 نانومتر باستخدام قارئ Thermo (Multiskan FC). تم قياس محتوى الكولاجين الكلي باستخدام مقايسة Woessner hydroxyproline [20]. تم تحديد محتوى الهيدروكسي برولين بواسطة قياس الألوان ، وتم تحويل إجمالي هيدروكسي برولين إلى كولاجين باستخدام عامل الضرب 8.2 [21].

تحضير وتوصيف جزيئات الغضروف منزوعة الخلايا

تحضير جزيئات الغضروف منزوعة الخلايا

تم تقطيع أنسجة الغضروف الأصلية إلى قطع صغيرة بشفرة حلاقة قبل المزيد من طحنها إلى جزيئات صغيرة باستخدام طاحونة مبردة (ساينتز 48 لتر). تم تكييف إجراء إزالة الخلايا من طريقتنا السابقة [22]. باختصار ، تم غسل جزيئات الغضروف أولاً ثلاث مرات بمحلول مفرط التوتر (50 ملي محلول Tris-HCl و 1 M NaCl ، PH = 8) ومحلول ناقص التوتر (0.5 M Tris-HCl عازلة ، PH = 8). بعد ذلك ، تم تجميد الجسيمات في النيتروجين السائل وتم إذابتها في فرن 37 درجة مئوية لمدة ثلاث مرات. ثم تمت إضافة الجسيمات بمحلول 0.5٪ Triton X-100 لمدة 40 دقيقة مع التحريض المستمر لتدمير أغشية الخلايا وغسلها بالماء لمدة ثلاث مرات. لمزيد من القضاء على الحمض النووي ، تمت إضافة 200 U ml -1 محلول DNAse I واحتضانه عند 37 درجة مئوية لمدة 12 ساعة. أخيرًا ، تم غمر الجسيمات في محلول 50 ملي إيثيلين ديامينيترا-أسيتيك (EDTA) لمدة 20 دقيقة وغسلها بالماء لمدة ثلاث مرات. تم تجميد جزيئات الغضروف منزوعة الخلايا (DCPs) في النيتروجين السائل وتخزينها في ثلاجة عند درجة حرارة -20 درجة مئوية قبل الاستخدام.

إزالة الحمض النووي

تمت مقارنة جزيئات الغضروف للعينات الأصلية والمنزوعة الخلوية الملطخة بـ 4 ′ ، 6-Diamidino-2-phenylindole (DAPI) مع تأكيد إزالة الخلايا. لمزيد من التحقق من فعالية إزالة الحمض النووي ، تم تحديد كمية محتوى الحمض النووي لكل عينة باستخدام مقايسة Quant-iT TM Picogreen TM dsDNA كما هو موضح في قسم "الكميات من الحمض النووي".

توزيع حجم DCPs

بعد إزالة الخلايا ، تمت ملاحظة DCPs من أرانب حديثي الولادة أو الأحداث أو البالغين وتصويرها عن طريق المسح المجهري الإلكتروني (SEM) تحت الفحص المجهري منخفض الطاقة. تم حساب حجم الجسيمات لكل عينة ، وتم تحليل توزيعات حجم DCP بواسطة برنامج ImageJ.

توصيف DCPs

لمزيد من توصيف تأثير إجراء إزالة الخلايا على DCPs المختلفة ، تم قياس sGAG والكولاجين الكلي باستخدام اختبار Blyscan GAG ومقايسة Woessner hydroxyproline على التوالي ، كما هو موضح في قسم "الكميات من SGAG والكولاجين الكلي".

تحضير وتوصيف الهلاميات المائية المركبة من الكولاجين DCP

تحضير الهلاميات المائية المركبة الكولاجين DCP

تم تحييد محلول كولاجين 1 هيدروجيل الذي تم استخراجه وتنقيته من جلد العجل تحت ظروف معقمة في مختبرنا [23] بواسطة محلول هيدروكسيد الصوديوم 1 مولار قبل خلطه مع DCPs التي تم تعقيمها بواسطة 60 تشعيعًا مشتركًا (عند 25 كيلو جرام). كان التركيز النهائي للكولاجين 10 مجم مل -1 و DCPs في محلول الخليط 20 مجم مل -1 على التوالي ، وكان المحلول مصبوبًا في قالب عند 37 درجة مئوية لتشكيل هيدروجيل مركب من الكولاجين- DCP (Φ 8 مم × ساعة. 2.5 ملم).

تحليل البنية المجهرية

تم تجفيف الهلاميات المائية المركبة من الكولاجين- DCP باستخدام الإيثانول المتدرج. لوحظت الهياكل المجهرية لهلاميات هيدروجيل مختلفة من الكولاجين- DCP من أرانب حديثي الولادة أو الأحداث أو البالغين تحت انبعاث حقل SEM (Hitachi S-4800 ، اليابان). تم استخدام هيدروجيلات الكولاجين بنفس البعد وتركيز الكولاجين كعنصر تحكم.

اختبار ميكانيكي

تم تحديد معامل التخزين والفقد الخاص بهيدروجيل الكولاجين وثلاثة هيدروجيلات مختلفة من الكولاجين DCP (Φ 8 مم × 2.5 مم) باستخدام محلل ميكانيكي ديناميكي (DMA ، TA-Q800 ، الولايات المتحدة الأمريكية) في درجة حرارة الغرفة وكانت خواصه الميكانيكية هي تقاس في وضع متعدد التردد (1-5 هرتز).

التحلل

تم تحديد تدهور هيدروجيل الكولاجين وثلاثة هيدروجيل مركب كولاجين دي سي بي (Φ 8 مم × ح 2.5 مم) في محلول كولاجيناز من النوع الأول (سيغما) مع 30 ميكروغرام مل عند 37 درجة مئوية في نقاط زمنية مختلفة. تم تسجيل WW لكل عينة في نقاط زمنية أولية (WW0) ، وتم حساب معدل التدهور في نقاط زمنية مختلفة كـ (WW0 - WWT) / WW0 × 100٪ ، حيث كانت WWT هي WW للعينة في نقاط زمنية مختلفة .

التمايز الغضروفي لـ BMSCs في هيدروجيل مركب الكولاجين DCP في المختبر

العزلة وثقافة BMSCs

باختصار ، تحت ظروف معقمة ، تم حصاد عظام طويلة من أرنب نيوزيلندا الأبيض الذي تم التضحية به حديثي الولادة. تم التخلص من نخاع العظم باستخدام حقنة تحتوي على 20٪ مصل بقري جنيني (FBS) و 1٪ بنسلين ستربتومايسين. The cell suspension was filtered through the cell strainer (BD) to remove tissue fragments, followed by centrifugation. The isolated cells were resuspended and cultured in 10-cm cell culture dishes and cultured in a-MEM containing 20% FBS and 1% penicillin-streptomycin. After 24 h, non-adherent cells were washed away, and the attached cells were cultured until reaching 90% confluence. The BMSCs were passaged and cultured in a-MEM containing 10% FBS and 1% penicillin-streptomycin until the third passage (P3) before used in further experiments.

Encapsulation of BMSCs in collagen and collagen-DCP composite hydrogels

Collagen I hydrogel solution was neutralized by 1 M NaOH solution before mixing with DCPs from newborn, juvenile or adult rabbits. The mixture of the collagen-DCP solution was then mixed with BMSCs (P3) to reach a final collagen concentration of 10 mg ml −1 and DCP concentration of 20 mg ml −1 , with the cell density of 3 × 10 6 ml −1 . The mixture solution was then casted in a mould at 37°C to form a collagen-DCP composite hydrogel (Φ 8 mm × h 2.5 mm). Collagen hydrogels with the same BMSCs density, collagen concentration, and hydrogel dimension were also fabricated for comparison. The hydrogels were subsequently cultured in an ultra-low adhesion surface plate. The culture medium was prepared with 1% penicillin-streptomycin, 90 μg/ml VC, 0.35 mM L-proline, 1% ITS, 1% non-essential amino acids and 1% FBS with medium changing interval of 2 days.

Gross appearance and cell viability

The gross appearance of each sample was observed at Days 1, 3, 7, 14 and 21. The diameter of samples at different time points was recorded and compared. Fluorescein Diacetate (FDA)/ Propidium Iodide (PI) double staining was utilized for cell viability measurement at Day 3, 7 and 14. In brief, samples were gently rinsed in PBS for 5 min and incubated in dark for 5 min with the FDA-PI (1 μg ml −1 ) dye solution. Each sample was observed and photographed under a confocal laser scanning microscope (CLSM, Zeiss-LSM880).

Quantitation of DNA and sGAG

To determine the cell proliferation and sGAG secretion, samples were collected and lyophilized for 48 h in a freeze dryer. The dry weight was measured before digested in a papain solution. The cell proliferation (DNA content at different time points) and the sGAG quantity was analyzed using the Quant-iT TM picogreen TM dsDNA assay and the Blyscan GAG assay, which were previously described in Sections ‘Quantitation of DNA’ and ‘Quantitation of SGAG and total collagen’.

Histological and immunohistochemical staining

The BMSCs/hydrogel samples were collected at Days 1, 7, 14 and 21 and fixed with 4% paraformaldehyde. The fixed samples were dehydrated by a gradient of 15% and 30% sucrose. The sample was embedded in the optimal cutting temperature embedding agent and then sectioned (6 μm) in a frozen section machine (Leica, RM2016). The cell and tissue morphology in each sample were observed by Haematoxylin–Eosin (HE) staining, secretion of GAGs was detected by Toluidine blue (TB) staining, and calcium deposition was highlighted with the Alizarin red staining (ARS). Furthermore, immunohistochemical (IHC) of collagen Type II (COL2A1) was performed with the mouse monoclonal Collagen II antibody (1:200, Novus Biologicals, NB600-844) primary antibody and the goat anti-mouse IgG (H + L) HRP (1:200, Affinity, S0002) was the secondary antibody for COLII. In brief, the sections were blocked with goat serum for 2 h to block the non-specific antigen, before incubated with the primary antibodies at 4°C for 10 h. After washed three times with TBS, the sections were immersed with 0.3% H2ا2 for 10 min to deplete endogenous peroxidase, followed by incubation with the secondary antibody for 20 min. The sections were coloured with diamino-benzidine staining solution and re-dyed with haematoxylin. The sections were dehydrated by gradient ethanol and treated with xylene solution. Finally, the sections were sealed with neutral gum and observed under a light microscope (LEICA DM1000).

Cartilage formation of BMSCs in the collagen-DCP composite hydrogel في الجسم الحي

Subcutaneous implantation in nude mice

BMSCs in collagen and collagen-DCP composite hydrogel (Φ 8 mm × h 2.5 mm) were prepared as described in Section ‘Encapsulation of BMSCs in collagen and collagen-DCP composite hydrogels’, and pre-cultured في المختبر لمدة 3 أيام. Subcutaneous implantation in nude mice experiments strictly abided by the rules and regulations of the Sichuan University Ethics Committee. In brief, 24 male BALB/c nude mice (6 weeks old) were purchased from GemPharmatech Co. Ltd. After intraperitoneal injection with 10 mg ml −1 pentobarbital sodium, nude mice in anaesthesia condition were placed on an ultra-clean table covered with sterile sheets. The back skin of a nude mouse was disinfected with povidone–iodine, and ophthalmological scissors were used to cut a ∼1.5 cm incision on the back of a nude mouse. Four pre-cultured BMSCs/hydrogel constructs were implanted into two subcutaneous pockets before the skin incision was closed with 4-0 needle suture and disinfected with povidone–iodine. Finally, the nude mice were sent back to their original cages, before euthanasia at day 14 and 28. The implants were collected at each time points for further investigation.

Biochemical analysis

The gross appearance of each implant was observed before (Day 0), and 14/28 days after implantation. The diameter of samples at different time points were recorded and compared. The DNA and sGAG quantity in each sample were analyzed before (Day 0) and 14/28 days after the implantation using the Quant-iT TM picogreen TM dsDNA and Blyscan GAG assays that described in Sections ‘Quantitation of DNA’ and ‘Quantitation of sGAG and total collagen’. Histological staining of HE, TB and ARS, and the IHC staining of COL2 were performed on each implant at Days 0, 14 and 28. The detailed methodologies were described in Section ‘Histological and immunohistochemical staining’.

Gene expression analysis

The mRNA expression levels of four chondrogenic genes (Aggrecan, COL2A1, SOX9 and collagen Type X [COL10A1]) in each implanted construct were analyzed at Days 14 and 28 using Quantitative Real-time PCR (qRT-PCR) technique. In brief, samples were washed with PBS and grinded in an enzyme-free tube with lysate. RNA was extracted using the RNeasy ® Mini Kit (Qiagen) and the RNA concentration was measured using a spectrophotometer (ND1000, Nanodrop Technologies). The isolated RNA was reverse transcribed into cDNA using the iScript TM cDNA Synthesis Kit (BIO-RAD). Finally, the cDNA in RNAse-free water was mixed with Ssofast EvaGreen Supermix (BIO-RAD) and the upstream and downstream primers, and the qRT-PCR was performed using the CFX96 TM qRT-PCR detection system (Bio-Rad, USA). The genes expression was determined by the software of BioRad CFX Manager, which calculated the relative gene expression based on the ΔΔCt method using the housekeeping gene of GAPDH. The forward and reverse primers’ sequences were referred from previous literature [ 24] and summarized in Table 1.

The forward and reverse primer sequences for qRT-PCR

Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
جابده TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC
Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
جابده TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC

The forward and reverse primer sequences for qRT-PCR

Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
جابده TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC
Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
جابده TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC

تحليل احصائي

The quantitative data involved in this experiment were presented as mean ± SD. The experimental data were compared by the t-test and the analysis of variance test method using SPSS software. *ص < 0.05 was considered to have a significant difference, **ص & lt 0.01 و ***ص < 0.001 were considered to be a higher level of significant difference.


استنتاج

This study established a new concept for cartilage regeneration𠅊nalogous to steel-reinforced concrete�sed on ECG and DBM and demonstrated its feasibility. Additionally, the formation method and relative parameters were investigated and optimized. However, some important issues, including how to precisely control the shape and realize homogeneity of the whole regenerated cartilage, still need to be investigated. The presented results provide a new cartilage regeneration strategy with potential for future clinical translation.


Hyaline Cartilage in Other Animals

Animals in the class الغضروفية have a skeleton composed completely of cartilage. أسماك القرش و أشعة are good examples of this. Cartilage is less dense than bone, yet still provides strength and therefore allows these animals to move quickly through the water without exerting too much effort.

Cartilage is also found in اللافقاريات، مثل horseshoe crabs, القواقع حلزون، و رأسيات الأرجل (predatory mollusks e.g. octopus and squid). The branchial cartilage in the arthropod Atlantic horseshoe crab (ليمولوس بوليفيموس), is rich in vacuolated chondrocytes that differs from any other arthropod.

Endosternite cartilage is another type found in this species. It is more fibrous than the hyaline cartilage found in vertebrates. It is found near the ventral nerve cords and gill cartilage tissue.

في ال أخطبوط (an example of a cephalopod), the cranial cartilage resembles hyaline cartilage and is one of the only hard parts of the octopus body. The growth of this cartilage occurs via cells moving from the outside to the center. In the common cuttlefish (Sepia officianalis), the cartilage is fibrillar collagen. The growth pattern of this cartilage is essentially the same as in vertebrate cartilage.

في gastropods (snails, slugs, or whelks), the odontophore is a cartilage formed feeding structure that provides feeding support. The odontophore is cell-rich cartilage containing myoglobin that is surrounded by a low volume of extracellular matrix and collagen.

أخيرًا ، في feather duster worms (Sabellid polychaetes), cartilage supports their tentacles.


1.9 Osteoarthritis Research

Osteoarthritis in humans has been extensively studied clinically. Since articular cartilage is avascular and aneural, a diagnosis of primary osteoarthritis is not made until a patient experiences pain in the joint, which signals later-stage disease. The main focus for human osteoarthritis research is to find a way to diagnose the disease early and accurately. The best-known human imaging project during the recent years is the Osteoarthritis Initiative (OAI), which is a multi-center observational study of human osteoarthritis sponsored by the National Institutes of Health in the USA. The OAI data are available publically on the internet. Many correlational studies have been published using various parts of the OAI data.

In addition to studies on human osteoarthritis, a large number of different domestic animals have been used in osteoarthritis studies. 206 However, none of the animal models reproduce all the features of human osteoarthritis. 207 A general consensus in the community is that there is no universal animal model to recapitulate the pathogenesis and progression of human osteoarthritis. 206,207 Despite the limitations, animal models are an integral and irreplaceable component of human osteoarthritis research. This is because no disease can be induced ethically in the human the only alternative for the entire biomedical community is to study the cellular and animal models of the human disease, in order to gain better insights that could be used to produce guidelines for human treatment.

1.9.1 في الجسم الحي Models of Osteoarthritis

Primary osteoarthritis progresses slowly over several decades. It is the most common form of osteoarthritis and increases in prevalence and severity with the age in both human and non-human animals. 207 Compared to the idiopathic and slow development of primary osteoarthritis, post-traumatic osteoarthritis in animals and humans is known to be induced as a consequence of injury, and often develops quite rapidly. Post-traumatic osteoarthritis can be reproduced by mechanical insult or by surgery. Since articular cartilage has a limited capacity for repair, the physiological response to the resulting tissue damage rarely restores a normal articular surface. Similarly, any changes in the cartilage structure caused by abnormal loading in a stable joint, or even by degradative enzymes in the synovium, can lead to the development of osteoarthritis. The assessment of animal models of osteoarthritis traditionally depends on the histological analysis of articular cartilage. Recent advances have seen the emergence of many other effective analyses, such as biomarkers and imaging, for monitoring the progress of osteoarthritis. 81,154–156,206,208,209

Although there is a perceived advantage in using naturally occurring models of osteoarthritis (على سبيل المثال Dunkin–Hartley guinea pigs) with a slower onset and progression similar to human osteoarthritis, 210 many investigators have utilized fast-advancing animal models first reported by Magnuson in 1941. 211 With a division of the medial collateral ligament and the cruciate ligaments in the joint, Magnuson showed osteoarthritis-like changes in articular cartilage. In 1952, Paatsama published a thesis describing the degradation of canine articular cartilage associated with a cranial cruciate ligament rupture. 212 Many studies from the 1970s onwards that used a similar model, or only the transection of the anterior cruciate ligament or a removal of the meniscus (menisectomy) showed reproducible histopathological changes including fibrillated articular surface, depleted proteoglycan content, and cloning of chondrocytes. 206,207,210

In addition to cartilaginous changes, Radin and Rose 191 showed alterations in the sub-chondral bone and the calcified zone of cartilage after application of repetitive sub-impact loads to the patellofemoral joint. Responses to traumatic injury were also studied using a direct impact applied to the patella using a "drop tower" type of apparatus in order to produce high-energy damage similar to that seen in human injuries. Intra-articular injections of many proteolytic enzymes such as trypsin, papain, and collagenase have also been used to trigger model osteoarthritis in mice, rats, and rabbits. However, the mechanisms responsible for cartilage degradation in these models, particularly those in which papain or trypsin was injected, may deviate significantly from those that normally occur in the human disease. Chemically induced osteoarthritis models use intra-articular injection of sodium iodoacetate to study acute cartilage toxicity and degradation and joint pain however, this has many limitations as a model of osteoarthritis. 213 For example, since sodium iodoacetate is a metabolic poison, this model exhibits extensive chondrocyte cell death, unlike naturally occurring osteoarthritis in humans. However, it does provide an في الجسم الحي model of rapid cartilage degradation mirroring some of the events observed في المختبر in organ culture screening studies. 214

1.9.2 في المختبر Models of Cartilage Degeneration

أضع ثقتي في في الجسم الحي animal studies concentrating on the outcomes of post-traumatic joints and progression of osteoarthritis, many في المختبر models have been used to study the effect of cell death and specific degradative mechanisms in well-defined loading and culture environments. 208,215–220 Many enzymes have been used to induce cartilage degradation في المختبر. For example, to investigate the potential use of imaging as a diagnostic tool for osteoarthritis, purified collagenase, trypsin, or chondroitinase ABC 217,218 have been used to digest bovine patellar cartilage in order to generate spatial and temporal changes in the cartilage matrix. Similar changes in structure and collagen network were observed in proteoglycan-depleted tissue and correlated directly with the loss of compressive strength. 215

As an alternative to enzymatic cleavage, many studies have used في المختبر explant injury models to study the molecular mechanisms of chondrocyte death and matrix degradation in injured cartilage. The relatively low compressive moduli and the compression-induced stiffening in the superficial zone are closely related to cell death following a blunt impact or repeated mechanical insults. This was well demonstrated في المختبر in a study of chondrocyte necrosis, where chondrocyte death occurred only in the superficial zone when two cartilage disks were positioned articular-surface-to-articular-surface and subjected to 1.0 MPa cyclic compression for 24 h, as shown in Figure 1.12. 216 The vulnerability of cells in the superficial zone is a feature often seen in early osteoarthritic cartilage and is significant in the initiation of post-traumatic osteoarthritis.

Some aspects of cartilage repair can also be examined في المختبر by osteochondral models, such as defects of different depths created using a dermal biopsy punch and a scalpel. 209 Lin وآخرون. 208 observed progressive changes in cell viability, collagen cleavage, and proteoglycan loss by cyclically loading cartilage explants with 1 and 5 MPa stresses for 24 h. Thibault وآخرون. 221 subjected cartilage explants to high but physiological cyclic load levels and characterized the resulting damage using a sequence of unconfined-compression stress-relaxation tests. These studies indicated that acute injury in articular cartilage can induce an upregulation of reactive oxygen species and pro-inflammatory cytokines. These are important areas of research, since the prevention of cell death and the inhibition of matrix-degrading enzymes in the injured joint are significant for the prevention of posttraumatic osteoarthritis. معا ، هؤلاء في المختبر explant models provide effective systems to study biomechanical and mechanobiological factors involved in initiating cartilage injury biochemical factors associated with cell death and matrix degradation and gene regulation critical for the advance of post-traumatic osteoarthritis.


شاهد الفيديو: Scanning Electron Microscope المجهر الإلكتروني الماسح (قد 2022).


تعليقات:

  1. Joseph Harlin

    انت لن تفعل ذلك.

  2. Taavi

    أعتقد، أنك لست على حق. يمكنني إثبات ذلك. اكتب لي في رئيس الوزراء ، سنناقش.

  3. Mars Leucetius

    في رأيي فأنتم مخطئون. دعونا نناقش. اكتب لي في PM.

  4. Nye

    حق تماما! أعتقد أنها فكرة جيدة.

  5. Remo

    شكرا لدعم كيف يمكنني أن أشكرك؟

  6. Gyamfi

    أنت مخطئ ... مخطئ على وجه التحديد



اكتب رسالة