معلومة

كيف يمكن لكلا خيوط DNA كود البروتينات ذات الوظائف المتشابهة؟

كيف يمكن لكلا خيوط DNA كود البروتينات ذات الوظائف المتشابهة؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

ليس واضحًا من السؤال ولكن على سبيل المثال:

AAAAAAA

TTTTTTT

سيخلق الشريط العلوي بروتينًا مختلفًا عن القاع ، ومع وجود كمية هائلة من النيوكليوتيدات في الجين ، أعتقد أنه من غير المحتمل جدًا أن تتمكن نفس المنطقة على كلا الجينين من تكوين بروتينات متشابهة مع بعضها البعض ، على الرغم من أنها الأليلات من نفس الجين. سيؤثر هذا أيضًا على السيادة المشتركة / الهيمنة غير الكاملة ، لأنني أفترض أن واحدًا فقط من الخيط سيخلق بروتينًا وظيفيًا.


أنت تخلط بين الخيوط الأمامية والخلفية للحمض النووي كأليلين. هم ليسوا. تذكر أن لديك حمض نووي مزدوج من كل والد. كل من هاتين القطعتين من المزدوج تقطعت بهم السبل يمثل الحمض النووي الأليلات لموضع معين.

في المثال الذي قدمته ، يمكن أن يكون لديك جينات مختلفة تتداخل مع نفس منطقة الحمض النووي. أحدهما في حبلا وجين مختلف على الآخر. يُقرأ الحمض النووي من 5 إلى 3 ، لذا فإننا نفكر في خصلة واحدة على أنها أمامية وخصلة واحدة عكسية.

انظر الموافقة المسبقة عن علم المضمنة للحصول على أمثلة من هذا المنشور حول أنواع مختلفة من التداخل وما إذا كانت محفوظة عبر الأنواع.


أعتقد أنه من غير المحتمل جدًا أن تخلق المنطقة نفسها في كلا الجينين بروتينات متشابهة مع بعضها البعض ، على الرغم من أنها أليلات من نفس الجين

أعتقد أن تفكيرك خاطئ هنا. ليس الأمر أن الأليلين في نفس الكروموسوم وكل منهما في حبلا واحد. كل أليل في كروموسوم مختلف (واحد من كل والد).

تعد الجينات المتداخلة أو المتداخلة موضوعًا مختلفًا تمامًا.


بشكل عام ، لا تتداخل جينات ترميز البروتين ، لذا لا تظهر المشكلة التي حددتها.

ولا ، الخيوط التكميلية ليست أليلات مختلفة. إذا كان الأمر كذلك ، فسيكون للبكتيريا والأمشاج أليلين من كل جين ، لأن كل منهما يحتوي على نسخة مزدوجة من الجينوم.

لديك نسختان من كل كروموسوم مزدوج الشريطة ، وهذا هو سبب وجود أليلين لكل جين.


عادةً لا يتداخل الجين بأكمله ، ولا يكون عادةً داخل الإطار ، وهذا يجعل الأمر أسهل كثيرًا.

لديك أيضًا بعض المرونة بسبب الكودونات الزائدة (20 AA مقابل 64 كودون) ، لذلك يمكنك تغيير كل قاعدة ثالثة أو أقل لتناسب الجين "الآخر".

قد تعني كلمة "مشابه" أي شيء ، وربما تشير إلى بروتينين ليسا متطابقين حتى بنسبة 20٪. عند 20 ٪ من الهوية ، لا يزال بإمكانك التأكد من أن هذا الإنزيم من نفس الفئة ، مما يحفز نفس التفاعل. قد يقبل ركائز مختلفة ، ولكن لا يزال بإمكانه أيضًا قبول نفس الركائز.

معًا ، هذا يعني أنه على الشريط غير المشفر لكل جين ، يمكنك وضع تشفير جيني لبروتين يقوم بنفس الشيء تقريبًا.


كيف يمكن لكلا خيوط DNA كود البروتينات ذات الوظائف المتشابهة؟ - مادة الاحياء

21. الحمض النووي والتكنولوجيا الحيوية

في الفصل السابق ، تعلمنا عن الأساس الكروموسومي للوراثة. في هذا الفصل ، أصبحنا على دراية ببنية ووظيفة الحمض النووي واكتشف كيف أن هذا الجزيء قادر على العمل كأساس لميراثنا الجيني وكذلك كمصدر لتنوع الحياة على الأرض. نتعلم أن أهمية الحمض النووي على المستوى الشخصي هو أنه يوجه تركيب عديد ببتيدات معينة (بروتينات) تلعب أدوارًا هيكلية أو وظيفية في أجسامنا. ثم نأخذ في الاعتبار التكنولوجيا التي أتاحها فهمنا للحمض النووي بالفعل وما هي الاحتمالات التي قد تحملها هذه التكنولوجيا للمستقبل.

شكل الحمض النووي

يشار إلى الحمض النووي أحيانًا على أنه خيط الحياة - وهو خيط رفيع جدًا. عندما يتم فك الحمض النووي ، فإنه يقيس قطره فقط 50 تريليون من البوصة. إذا تم ربط جميع خيوط الحمض النووي في خلية واحدة معًا من طرف إلى طرف ، فإن الخيط سيمتد أكثر من 5 أقدام في الطول. يمكن اعتبار الحمض النووي أيضًا الخيط الذي يربط جميع أشكال الحياة معًا ، لأن الحمض النووي للكائنات التي تتراوح من البكتيريا إلى البشر مبني من نفس الأنواع من الوحدات الفرعية. يقوم ترتيب هذه الوحدات الفرعية بترميز المعلومات اللازمة لصنع البروتينات التي تبني الحياة وتحافظ عليها.

حمض الديوكسي ريبونوكلييك ، أو الحمض النووي ، هو جزيء مزدوج تقطعت به السبل يشبه سلمًا ملتويًا برفق لتشكيل حلزوني يسمى الحلزون المزدوج ، كما هو موضح في الشكل 21.1. يتكون كل جانب من جوانب السلم ، بما في ذلك نصف كل درجة ، من سلسلة من الوحدات الفرعية المتكررة تسمى النيوكليوتيدات. قد تتذكر من الفصل 2 أن النيوكليوتيد يتكون من ثلاث وحدات فرعية ، بما في ذلك سكر واحد (deoxyribose ، في DNA) ، فوسفات واحد ، وقاعدة نيتروجينية واحدة. يحتوي الحمض النووي على أربعة أنواع من القواعد النيتروجينية: الأدينين (A) والجوانين (G) والثيمين (T) والسيتوزين (C). تتكون جوانب السلم من السكريات المتناوبة والفوسفات وتتكون الدرجات من قواعد نيتروجينية مقترنة. ترتبط القواعد ببعضها البعض وفقًا لقواعد الاقتران الأساسي التكميلي: أزواج الأدينين فقط مع الثايمين (تكوين زوج A-T) ، وأزواج السيتوزين فقط مع الجوانين (إنشاء زوج C-G). يتم تثبيت كل زوج أساسي معًا بواسطة روابط هيدروجينية ضعيفة. يعتبر الاقتران بين القواعد التكميلية محددًا نظرًا لأشكال القواعد وعدد الروابط الهيدروجينية التي يمكن أن تتشكل فيما بينها. قد تتذكر أيضًا من الفصل 2 أن الجزيء المتكون من اتحاد النيوكليوتيدات يسمى حمض نووي. وبالتالي ، فإن الحمض النووي هو حمض نووي.

· تعتمد بصمة الحمض النووي على تسلسل القواعد في الحمض النووي للشخص. وبالتالي ، فإن بصمة الحمض النووي فريدة لكل شخص (باستثناء أولئك الذين لديهم أشقاء متطابقون).

الشكل 21.1. الحمض النووي هو جزيء مزدوج تقطعت به السبل يلتف لتشكيل بنية حلزونية تسمى الحلزون المزدوج.

نظرًا لأن الاقتران الأساسي محدد جدًا ، فإن القواعد الموجودة على أحد خيوط الحمض النووي تكون دائمًا مكملة للقواعد الموجودة على الشريط الآخر. وبالتالي ، فإن ترتيب القواعد على أحد الخيطين يحدد تسلسل القواعد على الخيط الآخر. على سبيل المثال ، إذا كان تسلسل القواعد على أحد الخيطين هو CATATGAG ، فماذا سيكون التسلسل التكميلي؟ تذكر أن السيتوزين (C) دائمًا يتزاوج مع الجوانين (G) والأدينين (A) دائمًا مع الثايمين (T). نتيجة لذلك ، سيكون التسلسل التكميلي على الشريط المقابل هو GTATACTC.

يحتوي الحمض النووي داخل كل خلية بشرية على 3 مليارات زوج قاعدي مذهل. على الرغم من أن إقران الأدينين مع الثايمين والسيتوزين مع الجوانين هو أمر محدد ولا يختلف ، إلا أن تسلسل القواعد عبر طول جزيئات الحمض النووي المختلفة يمكن أن يختلف بطرق لا تعد ولا تحصى. كما سنرى ، يتم تشفير المعلومات الجينية في التسلسل الدقيق للقواعد.

تكرار الحمض النووي

لكي يكون الحمض النووي أساسًا للوراثة ، يجب أن تنتقل تعليماته الوراثية من جيل إلى آخر. علاوة على ذلك ، لكي يوجه الحمض النووي أنشطة كل خلية ، يجب أن تكون تعليماته موجودة في كل خلية. تملي هذه المتطلبات نسخ الحمض النووي قبل انقسام الخلايا الانقسامية والانقسام الخلوي (انظر الفصل 19). من المهم أن تكون النسخ دقيقة. مفتاح دقة عملية النسخ هو أن القواعد مكملة.

تبدأ عملية النسخ ، أو تكرار الحمض النووي ، عندما يكسر الإنزيم الروابط الهيدروجينية الضعيفة التي تربط القواعد المزدوجة التي تشكل خيوط النوكليوتيدات للحلزون المزدوج ، وبالتالي & quot ؛ ضغط & quot وفك الخيوط. نتيجة لذلك ، تتعرض القواعد النيتروجينية في المناطق المنفصلة لكل حبلا مؤقتًا. يمكن لقواعد النوكليوتيدات الحرة ، الموجودة دائمًا داخل النواة ، أن ترتبط بقواعد تكميلية على خيوط الحمض النووي المفتوحة. تربط إنزيمات تسمى بوليميرات الحمض النووي السكريات والفوسفات في النيوكليوتيدات المرتبطة حديثًا لتشكيل حبلا جديدًا. عندما يتشكل كل جزيء جديد من جزيئات الحمض النووي مزدوج الشريطة ، فإنه يتحول إلى حلزون مزدوج.

يعمل كل خيط من جزيء الحمض النووي الأصلي كقالب لتشكيل خيط جديد. تسمى هذه العملية النسخ شبه المتحفظ ، لأنه في كل جزيء جديد من جزيئات الحمض النووي مزدوج الشريطة ، يتم حفظ خيط أصلي (أصل) (محفوظ) والآخر (الابنة) جديد. انظر إلى الشكل 21.2. لاحظ الخيط الأصلي (الأبوي) للنيوكليوتيدات في كل جزيء جديد من الحمض النووي. يُنشئ الاقتران القاعدي التكميلي جزيئين جديدين من الحمض النووي متطابقين مع الجزيء الأصل.

الشكل 21.2. يُطلق على تكرار الحمض النووي اسم semiconservative لأن كل جزيء ابنة يتكون من حبلا "أبوي" واحد و "جديلة & quot جديدة.

التعبير الجيني

تضمن عملية النسخ أن المعلومات الجينية تنتقل بدقة من الخلية الأم إلى الخلايا الوليدة ومن جيل إلى جيل. السؤال التالي الواضح هو ، & quot؛ كيف يصدر الحمض النووي أوامر توجه الأنشطة الخلوية؟ & quot؛ والإجابة هي أن الحمض النووي يوجه تركيب حمض نووي آخر - الحمض النووي الريبي أو RNA. الحمض النووي الريبي ، بدوره ، يوجه تخليق بولي ببتيد (جزء من بروتين) أو بروتين. قد يكون البروتين جزءًا هيكليًا من الخلية أو يلعب دورًا وظيفيًا ، مثل الإنزيم الذي يسرع تفاعلات كيميائية معينة داخل الخلية.

تذكر من الفصل 20 أن الجين هو جزء من الحمض النووي يحتوي على تعليمات لإنتاج بروتين معين (أو في بعض الحالات ، بولي ببتيد معين) .1 يحدد تسلسل القواعد في الحمض النووي تسلسل القواعد في الحمض النووي الريبي ، والذي بدوره يحدد تسلسل الأحماض الأمينية للبروتين. نقول أنه يتم التعبير عن الجين عند إنتاج البروتين الذي يرمز إليه. البروتين الناتج هو الأساس الجزيئي للسمات الموروثة التي تحدد النمط الظاهري.

لتقدير كيفية عمل التعبير الجيني بشكل كامل ، سننظر في كل خطوة بتفصيل أكبر قليلاً.

مثلما يصدر الرئيس التنفيذي لشركة كبرى أوامر من المقر بدلاً من أرض المصنع ، يصدر الحمض النووي التعليمات من نواة الخلية وليس من السيتوبلازم حيث يتم عمل الخلية. الحمض النووي الريبي هو الوسيط الذي يحمل المعلومات المشفرة في الحمض النووي من النواة إلى السيتوبلازم ويوجه تركيب البروتين المحدد.

مثل الحمض النووي ، يتكون الحمض النووي الريبي من نيوكليوتيدات مرتبطة ببعضها البعض ، ولكن هناك بعض الاختلافات المهمة بين الحمض النووي والحمض النووي الريبي ، كما هو موضح في الجدول 21.1. أولاً ، تحتوي نيوكليوتيدات RNA على ريبوز السكر ، بدلاً من deoxyribose الموجود في DNA. ثانيًا ، في الحمض النووي الريبي ، يتزاوج النيوكليوتيدات uracil (U) مع الأدينين ، بينما في DNA thymine (T) أزواج مع الأدينين (A). ثالثًا ، معظم الحمض النووي الريبي هو واحد تقطعت به السبل. تذكر أن الحمض النووي هو جزيء مزدوج الشريطة.

الجدول 21.1. مقارنات بين DNA و RNA

تتكون من نيوكليوتيدات مرتبطة

لديك عمود فقري من السكر والفوسفات

هو جزيء مزدوج تقطعت به السبل

هو جزيء واحد تقطعت به السبل

يحتوي على قواعد الأدينين والجوانين والسيتوزين والثايمين

يحتوي على قواعد الأدينين والجوانين والسيتوزين واليوراسيل (بدلاً من الثايمين)

وظائف في المقام الأول في النواة

وظائف في المقام الأول في السيتوبلازم

تتمثل الخطوة الأولى في تحويل رسالة الحمض النووي إلى بروتين في نسخ الرسالة على أنها RNA ، من خلال عملية تسمى النسخ.

يتم إنتاج ثلاثة أنواع من الحمض النووي الريبي في الخلايا. يلعب كل منها دورًا مختلفًا في تخليق البروتين (الجدول 21.2). يحمل Messenger RNA (mRNA) تعليمات الحمض النووي لتخليق بروتين معين من النواة إلى السيتوبلازم. يحدد ترتيب القواعد في mRNA تسلسل الأحماض الأمينية في البروتين الناتج ، كما سنرى. يتخصص كل جزيء نقل RNA (tRNA) في إحضار حمض أميني معين إلى حيث يمكن إضافته إلى بولي ببتيد قيد الإنشاء. يتحد الحمض النووي الريبوزي (rRNA) مع البروتينات لتكوين الريبوسومات ، وهي الهياكل التي يحدث عليها تخليق البروتين.

الجدول 21.2. مراجعة وظائف RNA

يحمل معلومات الحمض النووي في تسلسل قواعده (الكودونات) من النواة إلى السيتوبلازم

يرتبط بحمض أميني معين وينقله لإضافته ، حسب الاقتضاء ، إلى سلسلة بولي ببتيد متنامية

يتحد مع البروتين لتكوين الريبوسومات (الهياكل التي يتم تصنيع البولي ببتيدات عليها)

يبدأ النسخ بفك وفك ضغط المنطقة المحددة من الحمض النووي المراد نسخها ، ويتم تنفيذ هذه الإجراءات بواسطة إنزيم. يتم تحديد رسالة الحمض النووي بترتيب القواعد في المنطقة غير المضغوطة من جزيء الحمض النووي. يعمل أحد الخيوط غير الملفوفة لجزيء الحمض النووي كقالب أثناء النسخ. توجد نيوكليوتيدات الحمض النووي الريبي في زوج النواة مع قواعدها التكميلية على القالب - السيتوزين مع الجوانين واليوراسيل مع الأدينين (الشكل 21.3). يتم إعطاء إشارة بدء النسخ من خلال تسلسل محدد من القواعد على الحمض النووي ، يسمى المحفز. يرتبط إنزيم يسمى RNA polymerase بالمحفز الموجود على الحمض النووي ثم يتحرك على طول شريط الحمض النووي ، ويفتح حلزون الحمض النووي أمامه ثم يقوم بمحاذاة نيوكليوتيدات الحمض النووي الريبي المناسبة ويربطها معًا منطقة الحمض النووي التي تم نسخ الكود البريدي مرة أخرى بعد يمر بوليميراز الحمض النووي الريبي. تسلسل آخر من القواعد على الحمض النووي يشير إلى بوليميراز الحمض النووي الريبي لوقف النسخ. بعد توقف النسخ ، يتم تحرير الشريط المكون حديثًا من الحمض النووي الريبي ، والذي يسمى نسخة الحمض النووي الريبي ، من الحمض النووي.

الشكل 21.3. النسخ هو عملية إنتاج الحمض النووي الريبي من قالب الحمض النووي.

يخضع الرنا الرسول عادةً لبعض التعديلات قبل أن يغادر النواة (الشكل 21.4). تتضمن معظم امتدادات الحمض النووي بين المحفز وإشارة التوقف مناطق لا تحتوي على أكواد سيتم ترجمتها إلى بروتين. تسمى هذه المناطق غير المعبر عنها من الحمض النووي الإنترونات ، وهي اختصار للتسلسلات المتداخلة. يتم قطع مناطق الرنا المرسال المقابلة للإنترونات من خيط الرنا المرسال المتشكل حديثًا بواسطة الإنزيمات قبل أن يترك الخيط النواة. الأجزاء المتبقية من الحمض النووي أو الرنا المرسال ، والتي تسمى exons للتسلسلات المعبر عنها ، تلتصق معًا لتشكيل التسلسل الذي يوجه تركيب البروتين.

الشكل 21.4. يتم تعديل الرنا المرسال حديث التكوين قبل أن يغادر النواة. يتم قطع المناطق غير المشفرة من الحمض النووي التي تسمى إنترونات من المناطق المقابلة لجزيء الرنا المرسال. ثم يتم تقطيع أجزاء من الرنا المرسال الذي يرمز للبروتين معًا.

يحمل الرنا المرسال الذي تم تكوينه حديثًا الرسالة الجينية (المنسوخة من الحمض النووي) من النواة إلى السيتوبلازم ، حيث يتم ترجمتها إلى بروتين في الريبوسومات. مثلما قد نترجم رسالة مكتوبة من الإسبانية إلى الإنجليزية ، فإن الترجمة تحول لغة النوكليوتيدات في الرنا المرسال إلى لغة الأحماض الأمينية للبروتين.

قبل فحص عملية الترجمة ، يجب أن نصبح أكثر دراية بلغة mRNA.

الكود الجيني . لاستخدام أي لغة ، يجب أن تعرف ما هي الكلمات وماذا تعني ، وكذلك أين تبدأ الجمل وتنتهي. الشفرة الوراثية هي & quotlanguage & quot للجينات التي تترجم تسلسل القواعد في الحمض النووي إلى تسلسل محدد للأحماض الأمينية في البروتين. لقد رأينا أن تسلسل القواعد في الحمض النووي يحدد تسلسل القواعد في mRNA من خلال الاقتران الأساسي التكميلي. & quotwords & quot في الشفرة الجينية ، تسمى الكودونات ، عبارة عن تسلسلات من ثلاث قواعد على mRNA تحدد واحدًا من الأحماض الأمينية العشرين أو بداية سلسلة البروتين أو نهايتها. يتم عرض جميع رموز الشفرة الجينية في الشكل 21.5. على سبيل المثال ، يحدد كودون UUC على الرنا المرسال الحمض الأميني فينيل ألانين. (سيكون التسلسل التكميلي للحمض النووي هو AAG.)

الشكل 21.5. الكود الجيني. كل تسلسل من ثلاث قواعد على جزيئات الرنا المرسال ، يسمى كودون ، يحدد حمض أميني معين ، أو إشارة بدء ، أو إشارة توقف.

إذا كان تسلسل القواعد التي تلي إشارة البدء هو AACUCAGCC ، فما الأحماض الأمينية التي سيتم تحديدها؟

اسبراجين ، سيرين ، ألانين

انظر إلى خيط الرنا المرسال في الشكل 21.3. لاحظ أن الكودون الموجود في نهاية خيط الرنا المرسال هو ACG. ما الأحماض الأمينية التي يحددها هذا؟ (استخدم الشكل 21.5.)

يمكن للقواعد الأربعة في الحمض النووي الريبي (A و U و C و G) أن تشكل 64 توليفة من متواليات ثلاثية القواعد. وبالتالي ، فإن عدد الكودونات الممكنة يتجاوز عدد الأحماض الأمينية. كما يوضح الشكل 21.5 ، هناك عدة مجموعات من الكودونات التي ترمز لنفس الحمض الأميني. لاحظ أيضًا أن الكودون AUG يمكن أن يعمل إما كإشارة بدء لبدء الترجمة أو يمكنه تحديد إضافة ميثيونين الأحماض الأمينية إلى سلسلة البروتين النامية ، اعتمادًا على مكان حدوثه في جزيء الرنا المرسال. بالإضافة إلى ذلك ، ثلاثة أكواد (UAA و UAG و UGA) هي أكواد توقف تشير إلى نهاية البروتين ولا ترمز إلى حمض أميني. إذا فكرنا في الكودونات على أنها كلمات وراثية ، فإن رمز الإيقاف يعمل كنقطة في نهاية الجملة.

نقل RNA مترجم لغة يترجم رسالة من لغة إلى أخرى. يعمل نقل الحمض النووي الريبي (الحمض النووي الريبي) كمترجم يحول الرسالة الجينية التي يحملها الرنا المرسال إلى لغة البروتين ، وهي سلسلة معينة من الأحماض الأمينية. لإنجاز هذا التحويل ، يجب أن يكون جزيء الحمض الريبي النووي النقال قادرًا على التعرف على كل من الكودون الموجود على الرنا المرسال والحمض الأميني الذي يحدده الكودون — وبعبارة أخرى ، يجب أن يتحدث كلتا اللغتين.

هناك أنواع عديدة من الحمض الريبي النووي النقال - نوع واحد على الأقل لكل من الأحماض الأمينية العشرين. كل نوع من جزيئات الحمض الريبي النووي النقال يرتبط بحمض أميني معين. تضمن الإنزيمات ارتباط الحمض الريبي النووي النقال بالحمض الأميني الصحيح. ثم تنقل الحمض النووي الريبي الحمض الأميني إلى الموقع الصحيح على طول حبلا من الرنا المرسال (الشكل 21.6).

الشكل 21.6. جزيء الحمض النووي الريبي (tRNA) هو خيط قصير من الحمض النووي الريبي (RNA) يلتوي وينطوي على نفسه. تتمثل وظيفة الحمض النووي الريبي في نقل حمض أميني معين إلى الريبوسوم وإدخاله في الموضع المناسب في سلسلة الببتيد المتنامية.

كيف يعرف الحمض الريبي النووي النقال الموقع الصحيح على طول الرنا المرسال؟ يتم تحديد الموقع من خلال سلسلة من ثلاثة نيوكليوتيدات على الحمض الريبي النووي النقال يسمى anticodon. بمعنى من المعاني ، يقتبس anticodon & يقتبس من لغة mRNA من خلال الارتباط بكودون على جزيء mRNA وفقًا لقواعد الاقتران الأساسي التكميلية. عندما يرتبط المضاد tRNA بكودون mRNA ، يتم إحضار الحمض الأميني المحدد المرتبط بـ tRNA إلى سلسلة polypeptide المتنامية. على سبيل المثال ، جزيء الحمض الريبي النووي النقال مع المضاد AAG يرتبط بالحمض الأميني فينيل ألانين وينقله إلى جزيء mRNA ، حيث يتم تقديم كودون UUC للترجمة. ثم يضاف فينيل ألانين إلى سلسلة الأحماض الأمينية المتنامية.

الريبوسومات . تعمل الريبوسومات كمناضد عمل تُبنى عليها البروتينات من الأحماض الأمينية. يتكون الريبوسوم من وحدتين فرعيتين (صغيرة وكبيرة) ، تتكون كل منهما من RNA الريبوسومي (rRNA) والبروتين. تتشكل الوحدات الفرعية في النواة ويتم شحنها إلى السيتوبلازم. تظل منفصلة إلا أثناء تخليق البروتين. يتمثل دور الريبوسوم في تخليق البروتين في جعل الحمض النووي الريبي الذي يحمل حمض أميني قريبًا بدرجة كافية من الرنا المرسال للتفاعل. كما ترون في الشكل 21.7 ، عندما تتلاءم الوحدتان الفرعيتان معًا لتشكيل ريبوسوم وظيفي ، يتشكل أخدود لـ mRNA.يضع موقعان للربط جزيئات الحمض الريبي النووي النقال (tRNA) بحيث يتسبب إنزيم في الريبوسوم في تكوين روابط بين أحماضها الأمينية.

الشكل 21.7. يتكون الريبوسوم من وحدتين فرعيتين بأحجام مختلفة. عندما تتحد وحدتان فرعيتان معًا لتشكيل ريبوسوم وظيفي ، يتشكل أخدود لـ mRNA. يحتوي الريبوسوم على موقعين لربط جزيئات الحمض النووي الريبي. يحتوي أيضًا على إنزيم يعزز تكوين رابطة ببتيدية بين الأحماض الأمينية المرتبطة بـ tRNAs في مواقع الارتباط.

تخليق البروتين . يمكن تقسيم الترجمة - بشكل أساسي ، تخليق البروتين - إلى ثلاث مراحل: البدء والاستطالة والإنهاء.

1. أثناء البدء ، يجتمع اللاعبون الرئيسيون في تخليق البروتين (mRNA و tRNA و ribosomes) معًا (الشكل 21.8).

• الخطوة 1: ترتبط الوحدة الفرعية الريبوزومية الصغيرة بحبلا mRNA في كودون البداية ، AUG.

• الخطوة 2: الحمض الريبي النووي النقال مع أزواج الأنتي كودون التكميلية مع كودون البداية. ثم تنضم الوحدة الفرعية الريبوسومية الأكبر للوحدة الأصغر لتشكيل ريبوسوم وظيفي سليم مع mRNA موضوعة في أخدود بين الوحدتين الفرعيتين.

الشكل 21.8. الشروع في الترجمة

2. يحدث استطالة البروتين عند إضافة أحماض أمينية إضافية إلى السلسلة (الشكل 21.9).

• الخطوة 1: التعرف على كودون. مع وضع كودون البداية في موقع ربط واحد ، يتم محاذاة الكودون التالي في موقع الربط الآخر.

• الخطوة 2: تكوين الرابطة الببتيدية. ينزلق الحمض الريبي النووي النقال الذي يحمل مضادًا لكودونًا مع الكودون المكشوف في مكانه في موقع الارتباط ، ويشكل الحمض الأميني الذي يحمله رابطة ببتيدية مع الأحماض الأمينية السابقة بمساعدة الإنزيمات.

• الخطوة الثالثة: حركة الريبوسوم. يترك الحمض الريبي النووي النقال في موقع الربط الأول الريبوسوم. يتحرك الريبوسوم على طول جزيء الرنا المرسال ، حاملاً سلسلة الببتيد المتنامية والحمض الأميني المتبقي بحمضه الأميني إلى موقع الارتباط الأول. تضع هذه الحركة الكودون التالي في الموقع المفتوح. ينزلق الحمض الريبي النووي النقال المناسب إلى الموقع المفتوح ، ويرتبط حمضه الأميني بالموقع السابق. تتكرر هذه العملية عدة مرات ، بإضافة حمض أميني واحد في كل مرة إلى سلسلة البولي ببتيد المتنامية.

الشكل 21.9. استطالة عديد الببتيد أثناء الترجمة

قد ينزلق العديد من الريبوسومات على طول خيط مرنا معين في نفس الوقت ، كل منها ينتج نسخته الخاصة من البروتين الموجه بواسطة هذا الرنا المرسال (الشكل 21.10). بمجرد أن يتحرك أحد الريبوسوم بعد كودون البداية ، يمكن أن يلتصق ريبوسوم آخر. يطلق على مجموعة من الريبوسومات تترجم في نفس الوقت نفس خيط الرنا المرسال اسم polysome.

الشكل 21.10. polysome عبارة عن مجموعة من الريبوسومات تقرأ جزيء mRNA نفسه.

3. يحدث الإنهاء عندما يتحرك كودون الإيقاف في الريبوسوم (الشكل 21.11).

• الخطوة 1: وقف الكودون ينتقل إلى الريبوسوم. لا توجد مضادات أكودونات الحمض النووي الريبي (tRNA) التي تقترن بكودونات الإيقاف ، لذلك عندما يتحرك كودون الإيقاف في الريبوسوم ، يتم إنهاء تخليق البروتين.

• الخطوة 2: فك الأجزاء. ثم ينفصل البولي ببتيد المركب حديثًا ، وحبلا الرنا المرسال ، والوحدات الفرعية الريبوسومية عن بعضها البعض.

الشكل 21.11. إنهاء الترجمة

الستربتومايسين مضاد حيوي ، وهو دواء يؤخذ لإبطاء نمو البكتيريا الغازية والسماح لآليات الدفاع عن الجسم بمزيد من الوقت لتدميرها. يعمل الستربتومايسين عن طريق الارتباط بالريبوسومات البكتيرية ومنع قراءة دقيقة لـ mRNA. لماذا تؤدي هذه العملية إلى إبطاء نمو البكتيريا؟

الحمض النووي مستقر بشكل ملحوظ ، وعمليات النسخ والنسخ والترجمة تحدث بشكل عام بدقة مذهلة. ومع ذلك ، في بعض الأحيان يتم تغيير الحمض النووي ، ويمكن أن تغير التعديلات رسالتها. التغييرات في الحمض النووي تسمى الطفرات. يحدث نوع واحد من الطفرات عندما يتم تكرار أو حذف أقسام كاملة من الكروموسومات ، كما تمت مناقشته في الفصل 20. والآن بعد أن أصبحنا على دراية بالتركيب الكيميائي للحمض النووي وكيف يوجه تكوين البروتينات ، يمكننا النظر في نوع آخر من الطفرات — a طفرة جينية. تنتج الطفرة الجينية عن التغيرات في ترتيب النيوكليوتيدات في الحمض النووي. على الرغم من أن الطفرة الجينية يمكن أن تحدث في أي خلية ، فإن الطريقة الوحيدة التي يمكن أن تنتقل بها إلى النسل هي إذا كانت موجودة في خلية ستصبح بويضة أو حيوان منوي. يمكن أن تؤثر الطفرة التي تحدث في خلية الجسم على عمل تلك الخلية والخلايا اللاحقة التي تنتجها تلك الخلية ، وفي بعض الأحيان يكون لها آثار كارثية ، ولكن لا يمكن أن تنتقل إلى نسل الشخص.

أحد أنواع الطفرات الجينية هو استبدال زوج من النوكليوتيدات بزوج نيوكليوتيدات مختلف في الحلزون المزدوج للحمض النووي. أثناء تكرار الحمض النووي ، قد تتزاوج القواعد عن طريق الخطأ بشكل غير صحيح. على سبيل المثال ، قد يقترن الأدينين عن طريق الخطأ بالسيتوزين بدلاً من الثايمين. عادةً ما تحل إنزيمات الإصلاح محل القاعدة غير الصحيحة بالقاعدة الصحيحة. ومع ذلك ، في بعض الأحيان ، تدرك الإنزيمات أن القواعد تم إقرانها بشكل غير صحيح ولكنها تحل محل القاعدة الأصلية (القاعدة الموجودة على الخيط القديم) بدلاً من القاعدة الجديدة غير الصحيحة. والنتيجة هي زوج قاعدة مكمل يتكون من نيوكليوتيدات خاطئة (الشكل 21.12).

الشكل 21.12. استبدال زوج القاعدة هو طفرة في الحمض النووي تنتج عندما يتم إقران القاعدة بشكل غير صحيح. قد يغير هذا الحمض الأميني المحدد بواسطة الرنا المرسال ويغير بنية البروتين.

تحدث أنواع أخرى من الطفرات الجينية بسبب إدخال أو حذف واحد أو أكثر من النيوكليوتيدات. بشكل عام ، يكون لطفرة من هذا النوع تأثيرات أكثر خطورة من الطفرة الناتجة عن استبدال زوج أساسي بآخر. تذكر أن mRNA يتم ترجمته في وحدات من ثلاثة نيوكليوتيدات (وحدة تسمى كودون). إذا تم إدخال أو حذف واحد أو اثنين من النيوكليوتيدات ، فمن المحتمل أن تتغير جميع الكودونات الثلاثية التي تتبع الإدراج أو الحذف. وبالتالي ، فإن الطفرات الناتجة عن إدخال أو حذف واحد أو اثنين من النيوكليوتيدات يمكن أن تغير البروتين الناتج بشكل كبير. توضح الجملة المكونة من كلمات مكونة من ثلاثة أحرف (تمثل الرموز) ما يمكن أن يحدث. حذف حرف واحد من الجملة & quot؛ The Big Fat Dog run & quot يجعل الجملة غير منطقية:

الأصل: THE BIG FAT DOG RAN

بعد حذف الحرف E في THE: THB IGF ATD OGR AN

تنظيم النشاط الجيني

في وقت الحمل ، تلقيت مجموعة واحدة من الكروموسومات من والدك ومجموعة أخرى من والدتك. ثم بدأت البيضة الملقحة الناتجة سلسلة رائعة من الانقسامات الخلوية - يستمر بعضها في العديد من خلايا الجسم حتى يومنا هذا. مع كل تقسيم ، تم نسخ المعلومات الجينية بأمانة ، وتم توزيع النسخ الدقيقة في الخلايا الوليدة. وبالتالي ، فإن كل خلية نواة تمتلكها ، باستثناء الأمشاج ، تحتوي على مجموعة كاملة من التعليمات الجينية المتطابقة لصنع كل بنية وأداء كل وظيفة في جسمك.

كيف ، إذن ، يمكن أن تبدو وتتصرف الكبد والعظام والدم والعضلات والخلايا العصبية بشكل مختلف عن بعضها البعض؟ الإجابة بسيطة بشكل مخادع: جينات معينة فقط هي التي تنشط في نوع معين من الخلايا ، ويتم إيقاف تشغيل معظم الجينات في أي خلية معينة ، مما يؤدي إلى التخصص في وظائف محددة. تنتج الجينات النشطة بروتينات معينة تحدد بنية ووظيفة تلك الخلية المعينة. في الواقع ، عندما تصبح الخلايا متخصصة في وظائف محددة ، فإن توقيت نشاط جينات معينة أمر بالغ الأهمية.

لكن ما الذي يتحكم في نشاط الجينات؟ الإجابة على هذا السؤال أكثر تعقيدًا بعض الشيء ، لأن نشاط الجينات يتم التحكم فيه بعدة طرق. يتم تنظيم الجينات على عدة مستويات في وقت واحد.

نشاط الجينات على مستوى الكروموسوم

على مستوى الكروموسوم ، يتأثر نشاط الجين بالتفاف وفك اللفائف للحمض النووي. عندما يتم لف الحمض النووي بإحكام أو تكثيفه ، لا يتم التعبير عن الجينات. عندما تكون هناك حاجة إلى بروتين معين في الخلية ، فإن منطقة الكروموسوم التي تحتوي على الجين الضروري تنفصل ، مما يسمح بالنسخ. من المفترض أن فك اللفافة يسمح للإنزيمات المسؤولة عن النسخ بالوصول إلى الحمض النووي في تلك المنطقة من الكروموسوم. تظل المناطق الأخرى من الكروموسوم ملفوفة بإحكام وبالتالي لا يتم التعبير عنها. في الواقع ، قد تؤثر البيئة على الجينات التي يتم تشغيلها أو إيقاف تشغيلها (انظر مقالة القضايا البيئية ، البيئة وعلم التخلق).

تنظيم نسخ الجينات

تنظم بعض مناطق الحمض النووي نشاط مناطق أخرى. كما رأينا ، المحفز هو تسلسل محدد من الحمض النووي يقع بجوار الجين الذي ينظمه. عندما ترتبط بروتينات تنظيمية تسمى عوامل النسخ بمحفز ، يمكن أن يرتبط RNA polymerase بالمحفز ، الذي يبدأ نسخ الجينات المنظمة.

يمكن أن ترتبط عوامل النسخ أيضًا بالمُعزِّزات ، وهي أجزاء من الحمض النووي تزيد من معدل نسخ جينات معينة ، وبالتالي كمية بروتين معين يتم إنتاجه. تحدد المعززات أيضًا توقيت التعبير واستجابة الجين للإشارات الخارجية والإشارات التنموية التي تؤثر على التعبير الجيني.

قد تتذكر من الفصل العاشر أن إحدى الطرق التي تؤدي بها هرمونات معينة إلى إحداث آثارها هي عن طريق تشغيل جينات معينة. هرمونات الستيرويد ، على سبيل المثال ، ترتبط بالمستقبلات داخل الخلية المستهدفة. ثم يجد مركب مستقبلات الهرمون طريقه إلى الكروماتين في النواة ويقوم بتشغيل جينات معينة. على سبيل المثال ، يعمل أحد هذه التعقيدات على تشغيل الجينات في الخلايا التي تنتج شعر الوجه - موضحًا لماذا قد يكون لوالدك لحية ولكن والدتك لا تمتلك لحية على الأرجح ، على الرغم من أن لديها الجينات اللازمة لتنميها. في هذه الحالة ، يرتبط هرمون التستوستيرون بمستقبلات ويقوم بتشغيل الجينات المنتجة للشعر. تحتوي خلايا بصيلات شعر الوجه لدى الرجال والنساء على مستقبلات التستوستيرون اللازمة. ومع ذلك ، فإن النساء عادة لا ينتجن ما يكفي من هرمون التستوستيرون لتنشيط الجينات المنتجة للشعر ، لذلك فإن النساء الملتحيات نادرة.

لماذا تقوم أحيانًا الرياضيات اللواتي يحقنن أنفسهن بالتستوستيرون لتحفيز نمو العضلات بتطوير شعر الوجه المتزايد؟

البيئة وعلم التخلق

قد يؤثر أسلوب حياتك على صحة حفيدك. كيف يكون هذا ممكنا؟ يمكن أن يحدث من خلال علم التخلق ، والذي يتضمن تغييرًا مستقرًا في التعبير الجيني دون تغييرات في تسلسل الحمض النووي. بمعنى آخر ، إنه ينظم كيفية التعبير عن الجينات دون تغيير البروتينات التي تكوّدها. سننظر في عمليتين جينيتين: مثيلة الحمض النووي وأسيتيل هيستون. تغير هذه العمليات التعبير الجيني من خلال التأثير على مدى إحكام حزم جزيء الحمض النووي. يتم تعبئة الحمض النووي بالبروتينات لتشكيل الكروموسومات. مثيلة الحمض النووي (إضافة مجموعة ميثيل إلى قواعد السيتوزين في الحمض النووي) يوقف نشاط الجين عن طريق جلب البروتينات التي تعمل على ضغط الحمض النووي في شكل أكثر إحكامًا. من ناحية أخرى ، فإن أسيتيل هيستون يجعل الحمض النووي أقل تماسكًا والتعبير الجيني أسهل.

نحن نعلم الآن أن هذه العمليات يمكن أن تتأثر بالبيئة وأن نمط مثيلة الحمض النووي ديناميكي ويتغير بمرور الوقت. يمكن أن تتأثر أنماط مثيلة الحمض النووي بالعوامل البيئية ، وتسبب المرض ، وتنتقل عبر الأجيال ، وربما تؤثر على التطور. الحمض النووي حساس للبيئة ، لذا فإن ما نأكله والمواد الكيميائية التي نتعرض لها ، بما في ذلك المبيدات الحشرية ودخان التبغ والهرمونات والمغذيات ، قد تؤثر على صحتنا من خلال التأثير على أنماط التعبير الجيني لدينا. على سبيل المثال ، يمكن أن تسبب تغذية الأم أثناء الحمل تغيرات جينية في نشاط الجينات في الجنين قد تزيد من التعرض للسمنة ومرض السكري من النوع 2 وأمراض القلب والسرطان. كمية الطعام المستهلكة أثناء الحمل تغير قابلية النسل للإصابة بأمراض القلب والأوعية الدموية. يُعتقد أيضًا أن الوراثة اللاجينية تلعب دورًا في الاضطرابات السلوكية البشرية ، مثل اضطرابات طيف التوحد (التي تمت مناقشتها في الفصل 18 أ) ، ومتلازمة ريت (اضطراب في النمو يؤثر على الجهاز العصبي) ، ومتلازمة X الهشة (شكل موروث من الإعاقة العقلية) ). على سبيل المثال ، هناك بعض الأدلة على أن الجين اللازم للاستجابة للأوكسيتوسين (هرمون مهم في الترابط الاجتماعي) يتم إيقافه لدى بعض الأشخاص المصابين بالتوحد. كما سنرى في الفصل 21 أ ، يتم التحكم في تطور السرطان عن طريق الجينات المثبطة للسرطان والمعززة للسرطان. إذا تم إيقاف تشغيل الجينات المثبطة للسرطان أو إذا تم تشغيل الجينات المعززة للسرطان فقد يؤدي ذلك إلى الإصابة بالسرطان. تم العثور على التغييرات في نمط التعبير الجيني في سرطانات عنق الرحم والبروستاتا والثدي والمعدة والقولون.

على الرغم من أن أنماط مثيلة الحمض النووي تعتبر مستقرة ، تشير بعض الدراسات إلى أن المثيلة يمكن عكسها في مرحلة البلوغ. الأطعمة مثل البروكلي والبصل والثوم قد تقلل من المثيلة ، مما يسمح بالتعبير عن الجينات. يبحث الباحثون بنشاط عن الأدوية التي من شأنها تغيير نمط المثيلة وعلاج السرطان.

• هل تعتقد أن علم التخلق يزيد أو يقلل من مسؤولية الشخص عن سلوكه؟

• قد يطور الباحثون يومًا ما "نظام غذائي جيني" يفضّل التغييرات الإيجابية في نشاط الجينات. هل ستتبع هذا النظام الغذائي؟ هل تعتقد أنه ينبغي مطالبة المرأة الحامل باتباع هذا النظام الغذائي؟

الهندسة الوراثية

بدأ التلاعب بالمواد الجينية للأغراض البشرية ، وهي ممارسة تسمى الهندسة الوراثية ، بمجرد أن بدأ العلماء في فهم لغة الحمض النووي. الهندسة الوراثية هي جزء من المسعى الأوسع للتكنولوجيا الحيوية ، وهو مجال يستخدم فيه العلماء الخلايا الحية بشكل منظم لأداء مهام محددة. تم استخدام الهندسة الوراثية لإنتاج المستحضرات الصيدلانية والهرمونات ، وتحسين تشخيص الأمراض البشرية وعلاجها ، وزيادة إنتاج الغذاء من النباتات والحيوانات ، واكتساب نظرة ثاقبة لعمليات نمو الخلايا.

الفكرة الأساسية وراء الهندسة الوراثية هي وضع الجين موضع الاهتمام - بمعنى آخر ، الجين الذي ينتج بروتينًا أو سمة مفيدة - في قطعة أخرى من الحمض النووي لتكوين الحمض النووي المؤتلف ، وهو عبارة عن دنا مدمج من مصدرين أو أكثر. يتم بعد ذلك وضع الحمض النووي المؤتلف ، الذي يحمل الجين المعني ، في خلية تتكاثر بسرعة وتنتج بسرعة العديد من نسخ الجين. قد يتكون الحصاد النهائي من كميات كبيرة من منتج الجين أو نسخ عديدة من الجين نفسه. دعنا نلقي نظرة فاحصة على الإجراء خطوة بخطوة.

1. يُقطع الجين المعني من كائنه الأصلي ويقسم إلى ناقل DNA. يتم قطع كل من الحمض النووي الذي يحتوي في الأصل على الجين المعني والحمض النووي الناقل ، الذي يستقبل الجينات المنقولة وينقلها إلى خلية جديدة ، في تسلسلات محددة يتعرف عليها إنزيم التقييد. هذا نوع من الإنزيمات يقوم بعمل قطع متدرج بين أزواج قاعدية معينة في الحمض النووي ، تاركًا عدة قواعد غير متزاوجة على كل جانب من جوانب القطع. هناك أنواع عديدة من إنزيمات التقييد التي يتعرف عليها كل نوع ويقطع تسلسلًا مختلفًا من الحمض النووي. يُطلق على امتداد القواعد غير المتزاوجة التي يتم إنتاجها على كل جانب من جوانب القطع النهاية اللاصقة نظرًا لميلها إلى الاقتران مع الامتدادات المفردة المتسلسلة لتسلسلات القاعدة التكميلية على نهايات جزيئات الحمض النووي الأخرى التي تم قطعها بنفس إنزيم التقييد (الشكل). 21.13).

الشكل 21.13. يمكن تقطيع الحمض النووي من مصادر مختلفة معًا باستخدام إنزيم تقييد لعمل جروح في الحمض النووي. يقوم إنزيم التقييد بعمل قطع متدرج في تسلسل معين من الحمض النووي ، مما يترك منطقة من القواعد غير المزدوجة على كل طرف مقطوع. تسمى منطقة الحمض النووي المفرد في نهاية القطع بالنهاية اللزجة ، لأنها تميل إلى الاقتران مع الطرف اللزج التكميلي لأي قطعة أخرى من الحمض النووي التي تم قطعها بنفس إنزيم التقييد ، حتى لو جاءت قطع الحمض النووي من مختلف مصادر.

النهايات اللاصقة هي سر تضفير الجين المعني والحمض النووي المتجه. ستكون الأطراف اللاصقة للحمض النووي من مصادر مختلفة مكملة وتلتصق ببعضها البعض طالما تم قطعها بنفس إنزيم التقييد. يعتبر الارتباط الأولي بين الأطراف اللاصقة مؤقتًا ، ولكن يمكن لصق النهايات معًا بشكل دائم بواسطة إنزيم آخر ، وهو DNA ligase. يحتوي الحمض النووي المؤتلف الناتج على DNA من مصدرين.

2. يستخدم الناقل لنقل الجين المعني إلى خلية مضيفة جديدة. تسمى الناقلات البيولوجية التي تنقل الحمض النووي المؤتلف إلى خلية مضيفة بالنواقل. النواقل الشائعة هي البلازميدات البكتيرية ، وهي عبارة عن قطع دائرية صغيرة من الحمض النووي ذاتي التكاثر والتي توجد بشكل منفصل عن الكروموسوم البكتيري. ناقل) يتم التعامل مع كل من الحمض النووي بنفس إنزيم التقييد. بعد ذلك ، سيتم دمج أجزاء من مصدر الحمض النووي ، والتي سيحتوي بعضها على الجين المعني ، في البلازميدات عندما تنضم أطرافها اللاصقة. يتم خلط الحمض النووي المؤتلف مع البكتيريا في أنبوب اختبار. في ظل الظروف المناسبة ، ستتناول بعض الخلايا البكتيرية البلازميدات المعاد تجميعها (الشكل 21.14).

الشكل 21.14. لمحة عامة عن الهندسة الوراثية باستخدام البلازميدات

على الرغم من أن الإستراتيجية الأساسية عادة ما تكون هي نفسها ، إلا أن هناك العديد من الاختلافات حول هذا الموضوع الخاص بنقل الجين إلى مضيف جديد. على سبيل المثال ، يتم أحيانًا دمج الجين المعني مع الحمض النووي الفيروسي. ثم يتم استخدام الفيروسات كنواقل لإدخال الحمض النووي المؤتلف في خلية مضيفة. يمكن أيضًا استخدام خلايا أخرى غير البكتيريا ، بما في ذلك الخميرة أو الخلايا الحيوانية ، كناقلات.

3. يتم التعرف على الكائن المؤتلف الذي يحتوي على الجين المعني وعزله من خليط المواد المؤتلفة. عند استخدام البلازميدات كدنا ناقل ، يتم إدخال كل بلازميد مؤتلف في خلية بكتيرية واحدة ، ثم يتم زراعة كل خلية في مستعمرة. تحتوي كل مستعمرة على بلازميد مؤتلف مختلف. يجب تحديد البكتيريا التي تحتوي على الجين المعني وعزلها.

4. يتم تضخيم الجين من خلال الاستنساخ البكتيري أو باستخدام تفاعل البلمرة المتسلسل. بعد تحديد المستعمرة التي تحتوي على الجين المعني ، يقوم الباحثون عادةً بتضخيم الجين (أي تكرار) الجين ، مما ينتج عنه نسخ عديدة. يتم إجراء تضخيم الجينات باستخدام إحدى طريقتين: الاستنساخ البكتيري أو تفاعل البلمرة المتسلسل.

استنساخ . يمكن أن تنمو البكتيريا التي تحتوي على البلازميد مع الجين المعني بأعداد ضخمة عن طريق الاستنساخ. تنقسم كل بكتيريا عدة مرات لتشكل مستعمرة. وهكذا ، فإن كل مستعمرة تشكل نسخة - مجموعة من الكائنات الحية المتطابقة وراثيا تنحدر جميعها من خلية واحدة. في هذه الحالة ، يحمل جميع أعضاء الاستنساخ نفس الحمض النووي المؤتلف. لاحقًا ، يمكن فصل البلازميدات عن البكتيريا ، وهي عملية تنقي جزئيًا الجين محل الاهتمام. يمكن بعد ذلك أن تمتص البلازميدات بواسطة بكتيريا أخرى ستصبح بالتالي قادرة على أداء خدمة يعتبرها الإنسان مفيدة. وبدلاً من ذلك ، يمكن أن تنتقل البلازميدات إلى نباتات أو خلايا حيوانية - مكونة كائنات حية معدلة وراثيًا - كائنات حية تحتوي على جينات من نوع آخر.

تفاعل البلمرة المتسلسل (PCR). في PSR (الشكل 21.15) ، يتم فك ضغط الحمض النووي المعني ، عن طريق التسخين اللطيف ، لكسر الروابط الهيدروجينية وتشكيل خيوط مفردة.ثم يتم خلط الخيوط المفردة ، التي ستعمل كقوالب ، مع مواد أولية - قطع قصيرة خاصة من الحمض النووي - أساس واحد مع قواعد مكملة لكل خصلة. تعمل البادئات كعلامات بدء لتكرار الحمض النووي. يتم أيضًا إضافة النيوكليوتيدات وبوليميراز الحمض النووي الخاص المقاوم للحرارة ، والذي يعزز تكرار الحمض النووي ، إلى الخليط ، والذي يتم تبريده بعد ذلك للسماح بإقران القاعدة. من خلال الاقتران الأساسي ، تتشكل خصلة تكميلية لكل خصلة واحدة. ثم يتم تكرار الإجراء عدة مرات ، وفي كل مرة يتضاعف عدد نسخ الحمض النووي محل الاهتمام. بهذه الطريقة ، يمكن إنتاج بلايين من نسخ الحمض النووي ذات الأهمية في وقت قصير.

الشكل 21.15. ينتج تفاعل البلمرة المتسلسل (PCR) بسرعة عددًا كبيرًا من النسخ من جين واحد أو أي جزء مرغوب فيه من الحمض النووي. يضخم PCR الحمض النووي بسرعة أكبر من الاستنساخ البكتيري. له استخدامات عديدة إلى جانب الهندسة الوراثية ، بما في ذلك بصمة الحمض النووي.

تتضمن الهندسة الوراثية تغيير جينات الكائن الحي - إضافة جينات وصفات جديدة للميكروبات أو النباتات أو حتى الحيوانات. هل تعتقد أن من حقنا أن "نلعب دور الرب" ونغير أشكال الحياة بهذه الطريقة؟ وافقت المحكمة العليا الأمريكية على تسجيل براءات اختراع لكائنات معدلة وراثيًا ، أولاً للميكروبات والآن للثدييات مثل الخنازير المعدلة وراثيًا لاستخدامها في زراعة الأعضاء. إذا طُلب منك أن تقرر ما إذا كان من الأخلاقي تسجيل براءة اختراع لشكل حياة جديد ، فكيف سترد؟

تطبيقات الهندسة الوراثية

تم استخدام الهندسة الوراثية بطريقتين عامتين.

• توفر الهندسة الوراثية طريقة لإنتاج كميات كبيرة من منتج جيني معين. يتم نقل الجين المفيد إلى خلية أخرى ، عادة ما تكون بكتيريا أو خلية خميرة ، والتي يمكن أن تنمو بسهولة بكميات كبيرة. تُزرع الخلايا في ظروف تجعلها تعبر عن الجين ، وبعد ذلك يتم حصاد منتج الجين. على سبيل المثال ، تم استخدام البكتيريا المعدلة وراثيًا لإنتاج كميات كبيرة من هرمون النمو البشري (الشكل 21.16). يسمح العلاج بهرمون النمو للأطفال الذين يعانون من خمول الغدة النخامية بالنمو إلى الطول الطبيعي تقريبًا.

• تسمح الهندسة الوراثية بأخذ جين للسمات التي يعتبرها الإنسان مفيدة من أحد الأنواع ونقلها إلى نوع آخر. ثم يعرض الكائن المعدل وراثيا الصفة المرغوبة. على سبيل المثال ، منح العلماء السلمون جينًا من سمكة شبيهة بالأنقليس. يتسبب هذا الجين في إنتاج السلمون لهرمون النمو على مدار العام (وهو أمر لا يفعله عادةً). نتيجة لذلك ، ينمو السلمون بشكل أسرع من المعتاد.

الشكل 21.16. تُستخدم الهندسة الوراثية لإنتاج كميات كبيرة من البروتين المطلوب أو لإنشاء كائن حي بالسمة المرغوبة. هذا الصبي لديه غدة نخامية خاملة. كان من الممكن أن يتسبب نقص إفرازه في هرمون النمو في أن يكون قصيرًا جدًا ، حتى عندما كان بالغًا. ومع ذلك ، فإن هرمون النمو من البكتيريا المعدلة وراثيًا قد ساعده على النمو إلى الارتفاع الطبيعي تقريبًا.

التطبيقات البيئية . للهندسة الوراثية أيضًا تطبيقات بيئية. على سبيل المثال ، في محطات معالجة مياه الصرف الصحي ، تقلل الميكروبات المعدلة وراثيًا من كمية الفوسفات والنترات التي يتم تصريفها في المجاري المائية. يمكن أن يتسبب الفوسفات والنترات في نمو مفرط للنباتات المائية ، والتي يمكن أن تخنق الممرات المائية والسدود ، والطحالب التي يمكن أن تنتج مواد كيميائية سامة للأسماك والماشية. يتم أيضًا تصميم الكائنات الحية الدقيقة جينيًا لتعديل أو تدمير النفايات الكيميائية أو الملوثات بحيث لا تكون ضارة بالبيئة. على سبيل المثال ، أثبتت الميكروبات التي تتغذى على الزيت والتي يمكنها تحمل تركيزات الملح العالية ودرجات الحرارة المنخفضة للمحيطات أنها مفيدة في التنظيف بعد انسكاب الزيت البحري.

الماشية . كما تم استخدام الهندسة الوراثية في الثروة الحيوانية. تم إنشاء لقاحات معدلة وراثيًا لحماية الخنازير من شكل من أشكال الزحار يسمى الجروح ، والأغنام ضد تعفن القدم والحصبة ، والدجاج ضد مرض الجراب (مرض فيروسي غالبًا ما يكون مميتًا). تنتج البكتيريا المعدلة وراثيًا سوماتوتروبين البقري (BST) ، وهو هرمون تنتجه الغدة النخامية للبقرة بشكل طبيعي ويعزز إنتاج الحليب. يمكن أن تؤدي حقن BST إلى زيادة إنتاج الحليب بنسبة 25٪ تقريبًا.

تم إنشاء الحيوانات المعدلة وراثيا عن طريق حقن البويضة المخصبة بالجين المعني في طبق بتري. تشمل أهداف إنشاء حيوانات معدلة وراثيًا صنع الحيوانات بلحوم أقل دهونًا ، وأغنامًا بها صوف أكثر ليونة ، وأبقارًا تنتج المزيد من الحليب ، وحيوانات تنضج بسرعة أكبر.

الأدوية . تم وضع الجينات في مجموعة متنوعة من الخلايا ، تتراوح من الميكروبات إلى الثدييات ، لإنتاج بروتينات لعلاج الحساسية والسرطان والنوبات القلبية واضطرابات الدم وأمراض المناعة الذاتية والالتهابات.

كما تم استخدام البكتيريا المعدلة وراثيًا لإنتاج لقاحات للبشر. قد تتذكر من الفصل 13 أن اللقاح عادةً ما يستخدم بكتيريا أو فيروسًا معطلاً لتحفيز الاستجابة المناعية للجسم تجاه الشكل النشط للكائن الحي. الفكرة هي أن الجسم سيتعلم كيف يتعرف على البروتينات الموجودة على سطح الكائن المعدي ويقيم دفاعات ضد أي كائن حي يحمل تلك البروتينات. نظرًا لأن الكائن الحي المستخدم في اللقاح أصبح غير ضار ، لا يمكن للقاح أن يتسبب في حدوث عدوى. ينتج العلماء لقاحات معدلة وراثيًا عن طريق وضع الجين الذي يرمز للبروتين السطحي للكائن الحي المعدي في البكتيريا. ثم تنتج البكتيريا كميات كبيرة من هذا البروتين ، والذي يمكن تنقيته واستخدامه كلقاح. لا يمكن للقاح أن يسبب العدوى ، لأنه يتم استخدام البروتين السطحي فقط بدلاً من الكائن الحي المعدي نفسه.

كما تم استخدام النباتات لإنتاج البروتينات العلاجية. يتم تطوير الموز المُعدّل هندسيًا الذي ينتج شكلاً معدلاً من البروتين السطحي لفيروس التهاب الكبد B باعتباره لقاحًا صالحًا للأكل ضد مرض الكبد الوبائي B. يتم أيضًا تصميم النباتات لإنتاج & اقتطاع الأجسام المضادة التي تصنعها النباتات. على سبيل المثال ، يتم زراعة فول الصويا الذي يحتوي على أجسام بشرية مضادة لفيروس الهربس البسيط الذي يسبب الهربس التناسلي. تم زرع جين بشري لجسم مضاد يرتبط بالخلايا السرطانية في الذرة. يمكن للأجسام المضادة بعد ذلك توصيل النظائر المشعة إلى الخلايا السرطانية ، وقتلها بشكل انتقائي.

Pharming هي كلمة تأتي من مزيج من كلمتي الزراعة والمستحضرات الصيدلانية. في التعديل الجيني ، يتم إنشاء الحيوانات المعدلة وراثيًا والتي تنتج بروتينًا له قيمة طبية في حليبها أو بيضها أو دمها. ثم يتم جمع البروتين وتنقيته لاستخدامه كدواء. عندما يكون حيوان فارم من الثدييات ، يتم التعبير عن الجين في الغدد الثديية. ثم يتم استخلاص البروتين المطلوب وتنقيته من الحليب (الشكل 21.17). على سبيل المثال ، تم إدخال جين البروتين alpha-1-antitrypsin (AAT) في الأغنام التي تفرز بعد ذلك AAT في حليبها. الأشخاص المصابون بنوع وراثي من أشكال انتفاخ الرئة (مرض رئوي) قد يكون مميتًا يأخذون AAT كدواء. كما يتم اختباره كدواء لمنع تلف الرئة لدى الأشخاص المصابين بالتليف الكيسي. كان أول دواء مصنوع من حليب الماعز المعدلة وراثيا هو عقار مضاد للتجلط يسمى ATryn. يُعطى للأشخاص الذين يعانون من نقص في تجلط الدم عندما يتعين عليهم الخضوع لعملية جراحية. ابتكر الباحثون أيضًا عنزة معدلة وراثيًا لإنتاج الحليب الذي يحتوي على الليزوزيم ، وهو عامل مضاد للجراثيم. يمكن استخدام الليزوزيم لعلاج الالتهابات المعوية التي تقتل ملايين الأطفال في البلدان المتخلفة.

الشكل 21.17. الإجراء الخاص بتكوين حيوان معدّل وراثيًا ينتج بروتينًا مفيدًا في حليبه

مواد أولية . تستخدم الهندسة الوراثية أيضًا لإنتاج مواد خام جديدة مفيدة. على سبيل المثال ، حرير العنكبوت أقوى بخمس مرات من الفولاذ وخفيف الوزن. بذلت محاولات لتربية العناكب للحصول على حريرها ، لكن العناكب عدوانية للغاية بحيث لا تستطيع العيش بالقرب من بعضها. تمت هندسة الماعز وراثيًا لامتلاك جين حرير العنكبوت وإفراز بروتينات حرير العنكبوت في حليبها (الشكل 21.18). في الآونة الأخيرة ، تم تعديل بكتيريا الإشريكية القولونية وراثيًا لإنتاج بروتينات حرير العنكبوت. يمكن غزل بروتينات حرير العنكبوت في خيط رفيع يمكن استخدامه في الملابس المقاومة للرصاص وخيوط الجراحة الرقيقة وسيارات السباق والطائرات الأقوى والأكثر خفة وزنًا.

الشكل 21.18. تمتلك هذه الماعز المعدلة وراثيا الجين لصنع حرير العنكبوت ، وهو أحد أقوى المواد المعروفة. يمكن استخلاص بروتين حرير العنكبوت من حليب الماعز وغزله في خيوط يمكن استخدامها في المنتجات التي تعتبر فيها القوة والوزن الخفيف من الصفات المهمة.

الزراعة . يختبر معظمنا بعض نتائج الهندسة الوراثية على موائد العشاء (انظر مقال قضية الصحة ، الغذاء المعدل وراثيًا). السمات الأكثر شيوعًا التي تم تعديلها وراثيًا في المحاصيل هي مقاومة الآفات ومقاومة مبيدات الأعشاب. كما طور العلماء سلالتين مقاومتين للفيروسات من البابايا ووزعوهما على مزارعي البابايا في هاواي ، مما ينقذ الصناعة من الخراب. بالإضافة إلى ذلك ، تمت هندسة سلالات مختلفة من الأرز وراثيًا لمقاومة البكتيريا المسببة للأمراض ولمقاومة فيضان الأرز. تم تصميم نباتات أخرى وراثيًا لتكون مغذية أكثر. على سبيل المثال ، الأرز الذهبي هو سلالة من الأرز تمت هندستها وراثيًا لإنتاج مستويات عالية من البيتا كاروتين ، وهو سلائف لفيتامين أ ، والذي يعاني من نقص في أجزاء معينة من العالم. يعاني أكثر من 100 مليون طفل في جميع أنحاء العالم من نقص فيتامين أ ، ويصاب 500000 منهم بالعمى كل عام بسبب هذا النقص. على الرغم من أن الأرز الذهبي لا يمكنه توفير جرعة يومية كاملة موصى بها من فيتامين أ ، إلا أن الكمية التي يحتويها يمكن أن تكون مفيدة للشخص الذي يكون نظامه الغذائي منخفضًا للغاية في فيتامين أ. كما تم إنشاء محاصيل أخرى تنمو بشكل أسرع وتنتج غلات أكبر ولها وقت أطول مدة الصلاحية.

تنشأ المشاكل المرتبطة بالعديد من الأمراض الوراثية بسبب فشل الجين الطافر في إنتاج منتج بروتيني طبيعي. الهدف من العلاج الجيني هو علاج الأمراض الوراثية عن طريق وضع جينات طبيعية وظيفية في خلايا الجسم التي تأثرت بالجين المتحور. ثم ينتج الجين الوظيفي البروتين المطلوب.

طرق توصيل الجين السليم . تتمثل إحدى طرق نقل الجين السليم إلى الخلية المستهدفة عن طريق الفيروسات. تهاجم الفيروسات بشكل عام نوعًا واحدًا فقط من الخلايا. على سبيل المثال ، الفيروس الغدي ، الذي يسبب نزلات البرد ، يهاجم عادة خلايا الجهاز التنفسي. يتكون الفيروس إلى حد كبير من مادة وراثية ، عادةً DNA ، محاطة بغلاف بروتيني (انظر الفصل 13 أ). بمجرد دخول الخلية ، يستخدم الحمض النووي الفيروسي آلية التمثيل الغذائي للخلية لإنتاج البروتينات الفيروسية. إذا تم تقسيم الجين السليم إلى الحمض النووي لفيروس تم جعله غير ضار في البداية ، فسينقل الفيروس الجين السليم إلى الخلية المضيفة ويتسبب في إنتاج منتج الجين المطلوب (الشكل 21.19).

نوع آخر من الفيروسات المستخدمة في العلاج الجيني هو الفيروسات القهقرية ، وهو فيروس يتم تخزين معلوماته الجينية على شكل RNA بدلاً من DNA. بمجرد دخول الفيروس القهقري إلى الخلية المستهدفة ، يعيد كتابة معلوماته الجينية على هيئة DNA مزدوج الشريطة ويدخل الحمض النووي الفيروسي في كروموسوم الخلية المستهدفة.

الشكل 21.19. العلاج الجيني باستخدام الفيروس. في العلاج الجيني ، يتم إدخال الجين السليم إلى المريض المصاب بمرض وراثي ناتج عن خلل في الجين.

الغذاء المعدل وراثيا

من موائد العشاء إلى الدوائر الدبلوماسية ، يناقش الناس الأطعمة المعدلة وراثيًا. هذا الاهتمام الحديث نسبيًا مثير للسخرية إلى حد ما ، بالنظر إلى أن الناس في الولايات المتحدة كانوا يأكلون الأطعمة المعدلة وراثيًا منذ منتصف التسعينيات. تحتوي أكثر من 70٪ من الأطعمة المصنعة المباعة في الولايات المتحدة على مكونات معدلة وراثيًا. ومع ذلك ، يعترض الكثير من الناس بشدة على الأغذية المعدلة وراثيًا.

لماذا يعتبر شيء شائع مثل الأطعمة المعدلة وراثيًا مثيرًا للجدل؟ يمكن تقسيم الاهتمامات المتعلقة به بشكل عام إلى ثلاث فئات: القضايا الصحية ، والقضايا الاجتماعية ، والقضايا البيئية. دعنا نستكشف هذه الفئات واحدة تلو الأخرى.

أصدرت لجنة من الأكاديمية الوطنية للعلوم (NAS) تقريرًا يقول إن المحاصيل المعدلة وراثيًا لا تشكل مخاطر صحية لا يمكن أن تسببها أيضًا المحاصيل الناتجة عن التكاثر التقليدي. ومع ذلك ، نظرًا لأن الهندسة الوراثية يمكن أن تنتج تغيرات ضارة غير مقصودة في الغذاء ، توصي لجنة NAS بفحص الأطعمة المعدلة وراثيًا قبل تسويقها. في الوقت الحالي ، تنظم وزارة الزراعة الأمريكية وإدارة الغذاء والدواء (FDA) ووكالة حماية البيئة الأطعمة المعدلة وراثيًا. خلصت لجنة NAS إلى أن الأطعمة المعدلة وراثيًا الموجودة بالفعل في السوق آمنة.

· تم تعديل سمك السلمون الأكبر في الجزء الخلفي من الصورة وراثيًا لينمو أسرع من السلمون العادي الموجود في المقدمة.

من مخاوف السلامة الشائعة أن الأطعمة المعدلة وراثيًا قد تحتوي على مسببات الحساسية (مواد تسبب الحساسية). بعد إنتاج البروتين ، تقوم الخلية بتعديله بطرق مختلفة. قد يتم تعديل البروتين في النبات المعدل وراثيًا بشكل مختلف عن الطريقة التي يتم بها تعديل البروتين في الخلية غير المعدلة ، ويمكن أن ينتج عن التعديل مادة مسببة للحساسية. يتم تقليل احتمالية حدوث ذلك عن طريق الاختبارات الصارمة. تشترك معظم المواد المسببة للحساسية المعروفة في خصائص معينة. وهي بروتينات وجزيئات صغيرة نسبيًا ومقاومة للحرارة والحموضة والهضم في المعدة. إذا كان للبروتين الذي ينتجه نبات معدّل وراثيًا أيًا من الخصائص النموذجية لمسببات الحساسية أو كان مشابهًا هيكليًا لمسببات الحساسية المعروفة ، فإن إدارة الغذاء والدواء الأمريكية تعتبره من مسببات الحساسية المحتملة وتتطلب أن يخضع البروتين لاختبار حساسية إضافي.

من المحتمل أن تشكل المقاومة البكتيرية للمضادات الحيوية تهديدًا كبيرًا للصحة العامة في هذا العقد (انظر الفصل 13 أ). عندما تكون البكتيريا مقاومة للمضادات الحيوية ، فإن الدواء لن يقتلها وبالتالي لن يعالج المرض البشري الذي تسبب فيه. يقلق بعض الناس بشأن الممارسة العلمية المتمثلة في وضع جينات مقاومة لمضاد حيوي في المحاصيل المعدلة وراثيًا كعلامات لتحديد النباتات ذات الجينات المعدلة. تُزرع الشتلات النباتية التي يُعتقد أنها معدلة وراثيًا في المختبر في وجود مضاد حيوي. فقط تلك الشتلات التي تحمل جين المقاومة ستبقى على قيد الحياة. تحتوي النباتات الباقية أيضًا على الجين "المفيد" بسبب طريقة هندستها.

ما يقلق بعض الناس هو أن الجينات المقاومة للمضادات الحيوية يمكن أن تنتقل إلى البكتيريا ، مما يجعل البكتيريا مقاومة للمضادات الحيوية. قد تكون البكتيريا المستقبلة هي تلك التي تعيش بشكل طبيعي في الجهاز الهضمي للإنسان ، أو قد تكون بكتيريا يتم تناولها مع الطعام. من غير المعروف ما إذا كان يمكن نقل الجينات من نبات إلى بكتيريا. ومع ذلك ، فمن المعروف أن البكتيريا يمكنها بسهولة وبسرعة نقل جينات مقاومة المضادات الحيوية لبعضها البعض. وهكذا ، يمكن لبكتيريا غير ضارة في الأمعاء أن تنقل الجين الخاص بمقاومة المضادات الحيوية إلى البكتيريا المسببة للمرض.

قد يكون لنقل الجينات المقاومة للمضادات الحيوية من النباتات المعدلة وراثيًا إلى البكتيريا عواقب وخيمة. لهذا السبب ، يتم التخلص التدريجي من جينات الواسمات المقاومة للمضادات الحيوية لصالح جينات واصمة أخرى ، مثل البروتين الفلوري الأخضر. طور العلماء أيضًا طريقة لتعطيل الجين المقاوم للمضادات الحيوية إذا كان سيتم نقله إلى البكتيريا.

يجادل مؤيدو الأغذية المعدلة وراثيًا بأن المحاصيل المقاومة لمبيدات الأعشاب والمبيدات تقلل من الحاجة إلى الرش بمبيدات الأعشاب ومبيدات الآفات. حتى الآن ، أظهرت التجربة أن صحة هذه الحجة تعتمد على المحصول. لقد قلل القطن المقاوم للآفات بشكل كبير من استخدام المبيدات ، ولكن الذرة المقاومة للآفات ربما لم تفعل ذلك. لا يزال المزارعون الذين يزرعون محاصيل مقاومة لمبيدات الأعشاب يرشون بمبيدات الأعشاب ، لكنهم يغيرون نوع مبيدات الأعشاب التي يستخدمونها إلى نوع أقل ضررًا للحيوانات.

لسوء الحظ ، يمكن أن يكون للمحاصيل المهندسة التي تحتوي على مبيدات حشرية تأثيرات غير مرغوب فيها على الحشرات. يمكن أن تسرع هندسة المبيدات الحشرية وراثيًا في النباتات من تطوير مقاومة الحشرات لهذا المبيد ، مما يجعل المبيد الحشري غير فعال - ليس فقط للمحاصيل المعدلة وراثيًا ، ولكن لجميع المحاصيل.

مصدر قلق آخر هو أن الكائنات المعدلة وراثيا يمكن أن تضر الكائنات الحية الأخرى. أحد الأمثلة هو أن حبوب اللقاح من الذرة المقاومة للآفات قد ثبت أنها تؤذي يرقات الفراشة الملكية. لحسن الحظ ، نادرًا ما تواجه اليرقات الملكية ما يكفي من حبوب اللقاح لتتأذي ، ومعظم الذرة المقاومة للآفات المزروعة في الولايات المتحدة اليوم لا تنتج حبوب اللقاح الضارة بالفراشات الملكية. والمثال الثاني للكائن الحي المعدل وراثيا الذي لديه القدرة على إيذاء الكائنات الحية الأخرى هو سمك السلمون الذي ينتج المزيد من هرمون النمو وينمو عدة مرات أسرع من أقاربهم البرية. يزرع هذا السلمون في مزارع الأسماك. إذا منحت إدارة الغذاء والدواء الأمريكية (FDA) الموافقة ، فإن السلمون المعدل جينيًا يمكن أن يخفض بشكل كبير التكاليف لمزارعي الأسماك والمستهلكين. ومع ذلك ، عندما ينمو السلمون المعدل وراثيا في خزانات مع سمك السلمون العادي ويندر الطعام ، يأكل السلمون المعدل وراثيا معظم الطعام وبعض من رفاقه العاديين. ماذا سيحدث إذا هرب السلمون المعدل وراثيًا من حظائره في مزرعة الأسماك؟ قد يتزاوجون مع السلمون البري وينشئون ذرية أقل صحة أو يتفوقون على سمك السلمون البري في الغذاء ، مما قد يتسبب في النهاية في انقراض السلمون البري. الهروب ممكن. خلال السنوات القليلة الماضية ، هرب مئات الآلاف من الأسماك من مزارع الأسماك عندما مزقت الحظائر العائمة بفعل العواصف أو أسود البحر. لتقليل مخاطر أن يؤدي سمك السلمون المعدل وراثيًا إلى تدمير مجموعات السلمون البري ، يخطط العلماء لتربية الأسماك في الداخل ، وتعقيم النسل ، وشحن الأسماك المعقمة فقط إلى الحظائر الساحلية. يعتبر إجراء التعقيم فعالاً على دفعات صغيرة من الأسماك ، لكن من غير المعروف ما إذا كان الإجراء فعالاً تمامًا في دفعات كبيرة من الأسماك.

يخشى منتقدو الأطعمة المعدلة وراثيًا أيضًا أن تصبح المحاصيل المعدلة وراثيًا لمقاومة مبيدات الأعشاب أعشابًا لا يمكن السيطرة عليها بالمواد الكيميائية الموجودة. في ولاية داكوتا الشمالية ، تنمو نباتات الكانولا المعدلة وراثيًا المقاومة لمبيدات الأعشاب على جوانب الطرق. يمكن تهجين الكانولا مع اثنين على الأقل من الأعشاب البرية. كانت السلالتان الأصليتان من الكانولا المعدلة وراثيًا مقاومة لمبيدات أعشاب مختلفة. نتيجة للتلقيح المتبادل ، فإن بعض نباتات الكانولا الموجودة في البرية تقاوم كل من مبيدات الأعشاب ، مما يشير إلى أن السمات المعدلة وراثيًا مستقرة في البرية وتتطور.

يدعي أنصار الأغذية المعدلة وراثيًا أن الأغذية المعدلة وراثيًا يمكن أن تساعد في المعركة ضد الجوع في العالم.لقد رأينا أن الهندسة الوراثية يمكن أن تنتج محاصيل تقاوم الآفات والأمراض. يمكن أن تنتج أيضًا محاصيل ذات غلات أكبر ومحاصيل ستنمو على الرغم من الجفاف أو التربة المستنفدة أو الملح الزائد أو الألمنيوم أو الحديد. يمكن أيضًا تعديل الأطعمة وراثيًا لاحتواء كميات أعلى من العناصر الغذائية المحددة.

يجادل منتقدو استخدام الأغذية المعدلة وراثيًا لمحاربة الجوع في العالم بأن مشكلة الجوع لا علاقة لها بالعجز عن إنتاج ما يكفي من الغذاء. يقولون إن المشكلة هي مشكلة اجتماعية تتمثل في توزيع الطعام بحيث يكون متاحًا للأشخاص الذين يحتاجون إليه.

تقاوم بعض البلدان النامية استخدام البذور المعدلة وراثيًا. جزء من المقاومة ينبع من المخاوف الصحية المستمرة. ومع ذلك ، فإن العديد من المزارعين في البلدان النامية يعترضون أيضًا على البذور المعدلة وراثيًا لأن النباتات المعدلة وراثيًا لا تزرع نفسها. تضع الحاجة إلى شراء البذور كل عام عبئًا ماليًا على عاتق المزارعين الفقراء.

• هل تعتبر الأغذية المعدلة وراثيًا نعمة أم خطرًا على العالم؟ ما هي اسبابك؟

• إذا بدأ كائن معدل وراثيًا تم إنشاؤه للغذاء في التسبب في مشاكل بيئية ، فمن يجب أن يتحمل المسؤولية؟

• هل تعتقد أن الأطعمة التي تحتوي على مكونات معدلة وراثيًا يجب أن توضع على هذا النحو؟

نتائج العلاج الجيني . تم تتبع أكثر من 4000 مرض يصيب الإنسان إلى عيوب في جين واحد. على الرغم من أن إدارة الغذاء والدواء لم توافق بعد على العلاج الجيني لأي من هذه الحالات ، إلا أن مئات التجارب السريرية للعلاجات الجينية جارية حاليًا ، بما في ذلك تجارب العلاجات الممكنة للتليف الكيسي والسرطان (تمت مناقشته في الفصل 21 أ).

كانت الحالة الأولى التي تم علاجها تجريبيًا بالعلاج الجيني هي اضطراب يُشار إليه بمرض نقص المناعة المشترك الشديد (SCID). الجهاز المناعي للأطفال المصابين باضطراب نقص الانتباه مع فرط النشاط لا يعمل ، مما يجعلهم عرضة للإصابة بالعدوى. سبب المشكلة هو جين متحور يمنع إنتاج إنزيم يسمى أدينوزين ديميناز (ADA). بدون ADA ، لا تنضج خلايا الدم البيضاء - تموت بينما لا تزال تنمو في نخاع العظام. بدأت أول تجربة للعلاج الجيني في عام 1990 ، عندما تمت هندسة خلايا الدم البيضاء لمريضة تبلغ من العمر 4 سنوات ، وهي Ashanthi DeSilva ، وراثياً لتحمل جين ADA ثم عادت إلى جسدها الصغير. بدأت خلايا الدم البيضاء المعدلة وراثيًا في إنتاج ADA ، وتم تعزيز آليات دفاع جسمها. بدأت حياة أشانثي تتغير. لم تكن مريضة كما كانت من قبل. يمكنها اللعب مع أطفال آخرين. ومع ذلك ، يتم قياس العمر الافتراضي لخلايا الدم البيضاء في الأسابيع ، وعندما ينخفض ​​عدد الخلايا المعدلة وراثيًا ، يجب حقن خلايا جديدة معدلة جينيًا. أشانثي الآن في العشرينيات من عمرها ولديها جهاز مناعة صحي بشكل معقول. ومع ذلك ، لا تزال بحاجة إلى علاجات متكررة.

يعتقد العلماء الفرنسيون أنهم عالجوا 10 أطفال مصابين بـ X-SCID باستخدام العلاج الجيني (الشكل 21.20). X-SCID هي متلازمة نقص المناعة المشترك الشديدة التي تسببها جين متحور على الكروموسوم X. لا يزال من السابق لأوانه معرفة ما إذا كان جميع الأطفال العشرة سيحتاجون إلى العلاج في المستقبل. ومع ذلك ، فإن أربعة أطفال في الدراسات الفرنسية الذين أظهروا تحسنًا في أعراض X-SCID أصيبوا بسرطان الدم من العلاج.

الشكل 21.20. يعتبر Rhys Evans أول شخص يتم علاجه من مرض نقص المناعة الشديد المرتبط بالكروموسوم X (X-SCID) عن طريق العلاج الجيني. الجهاز المناعي للشخص المصاب بـ X-SCID لا يعمل. تم تعزيز جهاز المناعة لدى Rhys Evans ، ويمكنه الآن الذهاب إلى الأماكن العامة دون خوف من الاتصال بالأشخاص الذين قد يحملون الجراثيم. يمكنه اللعب مع أطفال آخرين.

تم علاج شكل من أشكال الحثل العضلي مؤخرًا بالعلاج الجيني. قام الباحثون بتعبئة الفيروس بالشكل الطبيعي للبروتين الذي يعاني من نقص في هذا النوع من ضمور العضلات. ثم تم حقن الفيروس مباشرة في العضلات. ظل مستوى البروتين والتعبير الجيني للبروتين مرتفعًا لعدة أشهر ، مما أدى إلى استعادة بعض وظائف العضلات للمرضى.

بدون علاج ، يموت الأطفال المصابون بـ X-SCID في سن مبكرة. يبدو أن العلاج الجيني لـ X-SCID الذي تسبب في سرطان الدم لدى أربعة فتيان فرنسيين قد عالج هذا الاضطراب المميت لدى مرضى آخرين. إذا كان لديك طفل مصاب بـ X-SCID ، فهل تريده أن يتلقى هذا العلاج بالعلاج الجيني؟ لما و لما لا؟ ما هي العوامل التي قد تأخذها في الاعتبار عند اتخاذ قرارك؟

الجينوم هو المجموعة الكاملة من الجينات التي يحملها عضو واحد من النوع - في حالتنا ، شخص واحد. علم الجينوم هو دراسة الجينوم بأكمله وتفاعلات الجينات مع بعضها البعض ومع البيئة.

أحد أهداف علم الجينوم هو تحديد موقع وتسلسل الجينات. طور الباحثون أجهزة كمبيوتر عملاقة تقوم تلقائيًا بتسلسل (تحديد ترتيب القواعد في) الحمض النووي. تم استخدام أجهزة الكمبيوتر العملاقة على نطاق واسع في مشروع الجينوم البشري ، وهو جهد بحثي عالمي ، اكتمل في عام 2003 ، لتسلسل الجينوم البشري. نتيجة لذلك ، لدينا الآن فكرة عن مواقع الجينات على طول جميع أزواج الكروموسومات البشرية البالغ عددها 23 زوجًا وتسلسل ما يقدر بنحو 3 مليارات زوج قاعدي تشكل تلك الكروموسومات. على الرغم من أن العدد الدقيق للجينات البشرية لا يزال غير معروف على وجه اليقين ، يقدر العلماء الآن أن الجينوم البشري يتكون من 20.000 إلى 25.000 جين ، وليس 100.000 كما كان يعتقد في الأصل. أحد أسباب العدد الأصغر للجينات الفعلية هو أن العديد من عائلات الجينات لها وظائف مرتبطة أو زائدة عن الحاجة ، وبالتالي فهي قادرة على مشاركة جينات معينة ، بحيث تكون هناك حاجة لعدد أقل للقيام بجميع وظائف الجسم. والسبب الثاني هو أن العديد من الجينات معروفة الآن بتشفير أجزاء من أكثر من بروتين واحد.

بالإضافة إلى ذلك ، حدد الباحثون ورسموا خرائط لمواقع محددة على جينات كروموسومات معينة لأكثر من 1400 مرض وراثي. من المأمول أن تمنح هذه المعلومات العلماء قدرة أكبر على تشخيص وتحليل ومعالجة العديد من الأمراض البشرية البالغ عددها 4000 والتي لها أساس وراثي معروف. استنسخ الباحثون بالفعل الجينات المسؤولة عن العديد من الأمراض الوراثية ، بما في ذلك الحثل العضلي الدوشيني ، والورم الأرومي الشبكي ، والتليف الكيسي ، والورم العصبي الليفي. يمكن الآن استخدام هذه الجينات المعزولة لاختبار وجود نفس الجينات المسببة للأمراض لدى أفراد معينين. كما رأينا في الفصل 20 ، يمكن استخدام بعض الاختبارات الجينية لتحديد الأشخاص الحاملين لأمراض وراثية معينة مثل التليف الكيسي ، مما يسمح للعائلات بالاختيار بناءً على الاحتمالات المعروفة لإنجاب طفل مصاب ، ويمكن استخدام اختبارات مماثلة لتشخيص ما قبل الولادة وللتشخيص قبل أن تبدأ أعراض المرض. بعد تحديد الجين المرتبط بالمرض ، يمكن للعلماء دراسته لمعرفة المزيد عن البروتين الذي يرمز إليه وربما اكتشاف طرق لتصحيح المشكلة.

لقد تعلمنا أيضًا من مشروع الجينوم البشري أن البشر متطابقون في 99.9٪ من تسلسل جيناتهم. نظرًا لأن العلماء يكتسبون فهمًا أكبر لـ 0.1٪ من الحمض النووي الذي يختلف من شخص لآخر ، فإنهم يتوقعون معرفة المزيد حول سبب إصابة بعض الأشخاص بأمراض القلب أو السرطان أو مرض الزهايمر والبعض الآخر لا.

الهدف الثاني لعلم الجينوم هو فهم الآليات التي تتحكم في التعبير الجيني. أكثر من 95٪ من الحمض النووي البشري لا يرمز للبروتين ، ومع ذلك ، فإن بعض تسلسل الحمض النووي غير المشفر يعمل كمناطق تنظيمية تحدد متى وأين وكم من بروتينات معينة يتم إنتاجها. نظرًا لأن النشاط الجيني يلعب دورًا في العديد من الأمراض ، فإن دراسة كيفية تشغيل هذه المناطق للجينات أو إيقاف تشغيلها قد تؤدي إلى تقدم في التشخيص والعلاج.

إحدى الأدوات التي يستخدمها الباحثون في هذا الجهد هي المصفوفة الدقيقة ، والتي تتكون من آلاف تسلسلات الحمض النووي المختومة على شريحة زجاجية واحدة تسمى شريحة الحمض النووي. يستخدم الباحثون المصفوفات الدقيقة لمراقبة عدد كبير من مقاطع الحمض النووي لاكتشاف الجينات النشطة والتي يتم إيقاف تشغيلها في ظل ظروف مختلفة ، كما هو الحال في أنواع الأنسجة المختلفة ، أو مراحل التطور المختلفة ، أو في الصحة والمرض. على سبيل المثال ، قد يستخدمون المصفوفات الدقيقة لتحديد الجينات النشطة في الخلايا السرطانية ولكن ليس في الخلايا السليمة (الشكل 21-21). من المفترض أن الجينات النشطة في الخلايا السرطانية تلعب دورًا في تطور السرطان.

الشكل 21.21. مقارنة بين المصفوفات الدقيقة التي توضح نمط نشاط الجينات في سرطان البروستاتا والأنسجة الطبيعية. من المحتمل أن تلعب الجينات النشطة في الأنسجة المصابة بسرطان البروستاتا ولكن ليس في الأنسجة الطبيعية دورًا في تطور السرطان.

إلى جانب تحديد النشاط الجيني في الصحة والمرض ، فإن تحليل المصفوفة الدقيقة مفيد في تحديد التباين الجيني في أفراد المجتمع. بعض هذه الاختلافات الجينية هي في شكل تعدد الأشكال أحادي النوكليوتيدات (SNPs ، أو قصاصات). هذه هي تسلسلات الحمض النووي التي يمكن أن تختلف باختلاف نيوكليوتيد واحد من شخص لآخر ، ويعتقد أن الاختلافات في منتجات البروتين الخاصة بهم تؤثر على كيفية استجابتنا للإجهاد والأمراض ، من بين أشياء أخرى. نظرًا لأن الباحثين يتعلمون المزيد عن SNPs ، فقد يكونون قادرين على تطوير علاجات مخصصة للتركيب الجيني لكل فرد. هذه هي أنواع الاكتشافات التي يمكن أن تفتح الباب للعلاج الجيني. في حين أن العلاج الجيني الفردي قد يكون مفيدًا في المستقبل ، فإننا نستخدم بالفعل تحديد الفروق الفردية في الحمض النووي على أساس منتظم في بصمات الحمض النووي (انظر مقال القضية الأخلاقية ، وعلوم الطب الشرعي ، والحمض النووي ، والخصوصية الشخصية).

يشعر بعض الناس بالقلق من أنه بمجرد أن نعرف موقع ووظيفة كل جين ونتقن تقنيات العلاج الجيني ، فلن نقتصر بعد الآن على معالجة الجينات لإصلاح الجينات المعيبة ، ولكننا سنبدأ في تعديل الجينات لتعزيز القدرات البشرية. هل ينبغي السماح للناس بتصميم أطفالهم باختيار الجينات التي يعتبرونها متفوقة؟ ماذا تعتقد؟ حيث يجب أن يتم رسم الخط الفاصل؟ من يجب أن يرسم هذا الخط؟ من يجب أن يقرر أي الجينات "جيدة"؟

عندما تقع SNPs بالقرب من بعضها البعض على كروموسوم ، فإنها تميل إلى أن تكون موروثة معًا. تسمى مجموعة من SNPs في منطقة من الكروموسوم بالنمط الفرداني. مشروع HapMap الدولي هو اتحاد علمي يهدف إلى وصف التباين الجيني بين المجموعات السكانية. يقارن الباحثون المتعاونون في هذا المشروع ترددات النمط الفرداني في مجموعات من الأشخاص المصابين بمرض معين مع تلك الموجودة في مجموعة غير مصابة بالمرض ، على أمل تحديد الجينات المرتبطة بالمرض.

مقارنة جينومات الأنواع المختلفة

كما تم تحديد الحمض النووي لبعض الكائنات الحية المدروسة على نطاق واسع ، بما في ذلك الفأر وذبابة الفاكهة والدودة المستديرة والخميرة وعفن الوحل ونحل العسل. من هذه الجينومات ، يأمل علماء الوراثة في اكتساب بعض البصيرة في علم الأحياء الأساسي ، بما في ذلك المبادئ الأساسية لتنظيم الجينات داخل الجينوم ، وتنظيم الجينات ، والتطور الجزيئي. يشترك البشر في العديد من الجينات مع الكائنات الحية الأخرى. على سبيل المثال ، نشارك 50٪ من جيناتنا مع ذبابة الفاكهة و 90٪ من جيناتنا مع الفأر. هذه التشابهات الجينية هي دليل على ماضينا التطوري المشترك. من المحتمل أن تكون الجينات والآليات الجينية التي نشاركها مع الكائنات الحية الأخرى مهمة في تحديد شكل الجسم وكذلك التأثير على التطور والشيخوخة.

في الفصل 19 ، تعلمنا عن دورة الخلية. في الفصلين 20 و 21 ، تعلمنا عن الجينات ووراثةها وتنظيمها ، كما درسنا كيفية تأثير الطفرات على وظائف الجينات. في الفصل 21 أ ، نستخدم هذه المعلومات لفهم السرطان ، وهو مجموعة من الأمراض تؤدي فيها الطفرات في الجينات التي تنظم دورة الخلية إلى فقدان السيطرة على انقسام الخلايا.

علم الطب الشرعي والحمض النووي والخصوصية الشخصية

يمكن لما يسمى ببصمات الحمض النووي ، مثل البصمات التقليدية التي تتركها الأصابع ، أن تساعد في التعرف على الأفراد الذين ينتمون إليهم من بين عدد كبير من السكان. تشير بصمات الحمض النووي إلى تقنيات تحديد الأفراد على أساس السمات الفريدة للحمض النووي الخاص بهم. يمكن الحصول على بصمات الحمض النووي لأن العديد من مناطق الحمض النووي تتكون من تسلسلات صغيرة ومحددة من الحمض النووي تتكرر عدة مرات. الأكثر شيوعًا هي الوحدات المتكررة من 1 إلى 5 قواعد ، والتي تسمى التكرارات الترادفية القصيرة (STRs). يختلف عدد مرات تكرار هذه التسلسلات بشكل كبير من شخص لآخر ، من بضع إلى 100 تكرار. بسبب هذه الاختلافات ، يمكن استخدام المقاطع لمطابقة عينة من الحمض النووي للشخص الذي أنتجت خلاياه العينة.

تتمثل الخطوة الأولى في إعداد بصمة الحمض النووي في استخراج الحمض النووي من عينة الأنسجة. لا يهم نوع النسيج ، ويمكن مقارنة نوع واحد من الأنسجة بنوع آخر بنجاح. تشمل المصادر الشائعة الاستخدام الدم والسائل المنوي والجلد وبصيلات الشعر ، لأنها ليست مؤلمة جدًا لإزالتها ، أو متوفرة بسهولة ، أو تُترك في مسرح الجريمة.

أولاً ، يتم زيادة كمية الحمض النووي بشكل كبير باستخدام PCR ، كما هو موضح في الشكل 21.15. البادئات المستخدمة هي تسلسل محدد للمناطق على جانبي منطقة التكرار. ينتج عن هذا العديد من النسخ من منطقة التكرار ، والتي يتم تحليلها بعد ذلك لتحديد عدد التكرارات الموجودة.

الشكل 21. يتم تحديد نمط النطاقات في بصمة الحمض النووي من خلال تسلسل القواعد في الحمض النووي للشخص ، وبالتالي فهو فريد لكل شخص. يمكن للمطابقة بين بصمات الحمض النووي أن تحدد مصدر عينة الأنسجة من مسرح الجريمة بدرجة عالية من اليقين. أي بصمة الحمض النووي للمشتبه به تتطابق مع هذه العينة التي تم العثور عليها في مسرح الجريمة؟

يستخدم مكتب التحقيقات الفيدرالي 13 تقريرًا عن المعاملات المشبوهة كمجموعة أساسية لتحليل الطب الشرعي. تكون بصمة الحمض النووي الناتجة فريدة من نوعها للشخص الذي أنتج الحمض النووي. علاوة على ذلك ، فإن أي عينة DNA مأخوذة من نفس الشخص ستكون دائمًا متطابقة. لكن ملفات تعريف بصمات الأصابع الناتجة عن الحمض النووي لأشخاص مختلفين دائمًا ما تكون مختلفة (باستثناء ربما الأشقاء المتطابقين) ، لأن عدد وأحجام الشظايا يتم تحديدها من خلال التسلسل الفريد للقواعد في الحمض النووي لكل شخص.

لبصمات الحمض النووي العديد من التطبيقات ، ولكن الأكثر شيوعًا هو استخدامها في التحقيقات الجنائية. في هذه الحالات ، يتم إنشاء بصمة الحمض النووي عادةً من عينة من الأنسجة ، مثل الدم أو بصيلات الشعر ، التي يتم جمعها من مسرح الجريمة. يمكن إنتاج بصمة الإصبع من الأنسجة التي تركت في مكان الحادث قبل سنوات. ثم تتم مقارنة بصمات الأصابع هذه ببصمات الحمض النووي للعديد من المشتبه بهم. يكشف التطابق بدرجة عالية من اليقين عن الشخص الذي كان مصدر العينة من مسرح الجريمة (شكل 21 أ).

بالطبع ، تعتمد درجة اليقين في التطابق بين بصمات الحمض النووي على مدى دقة إجراء التحليل. نظرًا لاستخدام بصمات الحمض النووي كدليل في عدد متزايد من قضايا المحاكم كل عام ، فمن المهم وضع معايير وطنية لضمان موثوقية هؤلاء الشهود الجزيئي. من الأسهل عمومًا أن نعلن على وجه اليقين أن بصمتين من بصمات الحمض النووي غير متطابقة مما هو عليه للتأكد من أنهما متطابقتان. في الولايات المتحدة ، تم العثور على أكثر من 200 مدان أبرياء من خلال اختبار الحمض النووي خلال العقد الماضي.

هل ذهب اختبار الحمض النووي بعيدًا جدًا؟ تقوم جميع الولايات في الولايات المتحدة بجمع عينات الحمض النووي من الأشخاص المدانين بجرائم جنسية وجرائم قتل. تقوم عدة ولايات أخرى أيضًا بجمع عينات الحمض النووي من الأشخاص المدانين بجرائم أخرى ، مثل السرقة. تقوم حوالي 30 ولاية بجمع عينات الحمض النووي من الأشخاص المتهمين بارتكاب جنح ، بما في ذلك التسكع أو السرقة أو التخريب. في كثير من الحالات ، يتم تخزين الحمض النووي في قاعدة بيانات ، حتى لو ثبت أن الشخص بريء من الجريمة. الأشخاص الذين يتعاونون ببساطة مع التحقيق قد يقدمون أيضًا عينات من الحمض النووي. هذه ، أيضا ، تضاف إلى قاعدة بيانات وطنية.

• هل تعتقد أنه يجب أن يكون لكل شخص تم القبض عليه في جريمة ما الحق في أخذ بصمات الحمض النووي لإثبات براءته؟ إذا كان الأمر كذلك ، فمن يجب أن يدفع مقابل هذه العملية؟

• هل إنشاء قاعدة بيانات وطنية لبصمات الحمض النووي يعد انتهاكًا للخصوصية؟ هل هو أكثر من مجرد قاعدة بيانات لبصمات الأصابع الفعلية أو لقطات الأكواب؟

• في أي ظروف تعتقد أنه ينبغي الحصول على عينات الحمض النووي؟

إبراز المفاهيم

• يتكون الحمض النووي من خيطين من النيوكليوتيدات متصلين بروابط هيدروجينية وملتوية معًا لتشكيل حلزون مزدوج. يتكون كل نوكليوتيد من فوسفات ، وسكر يسمى ديوكسيريبوز ، وواحدة من أربع قواعد نيتروجينية: الأدينين ، الثايمين ، السيتوزين ، أو الجوانين. تتناوب مكونات السكر والفوسفات في النيوكليوتيدات على جانبي الجزيء. تلتقي أزواج القواعد وتشكل روابط هيدروجينية في داخل اللولب المزدوج ، وتشبه هذه الأزواج الدرجات الموجودة على سلم.

• وفقًا لقواعد الاقتران الأساسي التكميلي ، يرتبط الأدينين مع الثايمين فقط ، بينما يرتبط السيتوزين بالجوانين فقط.

تكرار الحمض النووي (ص 435-436)

• تكرار الحمض النووي هو شبه محافظ. يتكون كل جزيء DNA جديد مزدوج الشريطة من خيط قديم وآخر جديد. إنزيم بوليميراز DNA & quotunzips & مثل خيطي جزيء (الجزيء الأصلي) ، مما يسمح لكل خيط أن يعمل كنموذج لتشكيل حبلا جديد. يضمن الاقتران الأساسي التكميلي دقة النسخ المتماثل.

التعبير الجيني (ص 436-441)

• يتم نسخ المعلومات الجينية من DNA إلى RNA ثم تُترجم إلى بروتين.

• النسخ هو تخليق الحمض النووي الريبي عن طريق الاقتران الأساسي في قالب الحمض النووي. يختلف الحمض النووي الريبي عن الحمض النووي في أن ريبوز السكر يحل محل الديوكسيريبوز ، ويحل اليوراسيل الأساسي محل الثايمين. معظم الحمض النووي الريبي هو واحد تقطعت به السبل.

• يحمل Messenger RNA (mRNA) رسالة DNA الجينية إلى السيتوبلازم ، حيث يتم ترجمتها إلى بروتين. تتم قراءة الشفرة الجينية في تسلسل من ثلاثة نيوكليوتيدات RNA كل ثلاثة توائم يسمى كودون. يحدد كل من الكودونات الـ 64 حمضًا أمينيًا معينًا أو يشير إلى النقطة التي يجب أن تبدأ أو تتوقف عندها الترجمة.

• نقل الحمض النووي الريبي (الحمض النووي الريبي) يفسر الشفرة الجينية. يوجد في أحد طرفي جزيء الحمض الريبي النووي النقال سلسلة من ثلاثة نيوكليوتيدات تسمى anticodon تتزاوج مع كودون على mRNA وفقًا لقواعد الإقران الأساسي. يرتبط ذيل الحمض النووي الريبي (tRNA) بحمض أميني معين.

• تتكون كل من وحدتين فرعيتين من الريبوسوم من الريبوسوم RNA (الرنا الريباسي) والبروتين. يجمع الريبوسوم الحمض الريبي النووي النقال و الرنا المرسال معًا لتخليق البروتين.

• تبدأ ترجمة الكود الجيني إلى بروتين عندما تتجمع وحدتا الريبوسوم و mRNA ، مع وجود الرنا المرسال في أخدود بين وحدتي الريبوسوم. يرتبط الرنا المرسال بالريبوسوم في كودون بدء الرنا المرسال. ثم ينزلق الريبوسوم على طول جزيء الرنا المرسال ، ويقرأ كودونًا واحدًا في كل مرة. تنقل جزيئات الحمض النووي الريبي الأحماض الأمينية إلى الحمض النووي الريبي وتضيفها إلى سلسلة البروتين النامية. تتوقف الترجمة عند مصادفة رمز الإيقاف. ثم تنفصل سلسلة البروتين عن الريبوسوم.

• الطفرة النقطية هي تغيير في واحد أو عدد قليل من النيوكليوتيدات في تسلسل جزيء DNA. عندما يتم استبدال أحد النوكليوتيدات عن طريق الخطأ بأخرى ، فإن وظيفة البروتين الناتج قد تؤثر أو لا تؤثر على وظيفة البروتين. يؤدي إدخال أو حذف النيوكليوتيدات دائمًا إلى تغيير البروتين الناتج.

تنظيم النشاط الجيني (ص 442)

• يتم تنظيم نشاط الجينات على عدة مستويات. عادة ، يتم طي معظم الحمض النووي ولفه. لكي يكون الجين نشطًا ، يجب أن تكون منطقة الحمض النووي التي يقع فيها غير ملفوفة. يمكن أن يتأثر نشاط الجينات بقطاعات أخرى من الحمض النووي. يمكن لمناطق الحمض النووي التي تسمى المعززات أن تزيد من كمية الحمض النووي الريبي المنتجة. يمكن أن تؤثر الإشارات الكيميائية مثل البروتينات التنظيمية أو الهرمونات أيضًا على نشاط الجين.

الهندسة الوراثية (ص 442-450)

• الهندسة الوراثية هي التلاعب الهادف بالمواد الوراثية من قبل البشر. يمكن استخدامه لإنتاج كميات كبيرة من منتج جيني معين أو لنقل سمة وراثية مرغوبة من نوع إلى آخر أو إلى عضو آخر من نفس النوع.

• تستخدم الهندسة الوراثية إنزيمات تقييدية لقطع الحمض النووي المصدر ، الذي يحتوي على الجين المعني ، والحمض النووي المتجه في أماكن محددة ، مما يخلق أطرافًا لزجة مكونة من قواعد تكميلية غير مقترنة تسمح للقطاعات المقطوعة بإعادة الاتحاد. ثم يتم استخدام الناقل المؤتلف لنقل الحمض النووي المؤتلف إلى خلية مضيفة. تشمل النواقل الشائعة البلازميدات الجرثومية والفيروسات. غالبًا ما تكون الخلية المضيفة نوعًا من الخلايا التي تتكاثر بسرعة ، مثل خلية بكتيرية أو خميرة. في كل مرة تنقسم فيها الخلية المضيفة ، تتلقى كلتا الخلايا الوليدة نسخة من الجين المعني. ينتج عن إدخال جين من نوع واحد إلى نوع مختلف نبات أو حيوان معدّل وراثيًا.

• للهندسة الوراثية تطبيقات عديدة في الزراعة النباتية والحيوانية وعلوم البيئة والطب.

• في العلاج الجيني ، يتم إدخال شكل صحي من الجين إلى خلايا الجسم لتصحيح المشاكل التي يسببها الجين المعيب.

• يتكون الجينوم من جميع الجينات في كائن حي واحد.

علم الجينوم هو دراسة الجينوم والتفاعل بين الجينات والبيئة. يُعتقد الآن أن الجينوم البشري يتكون من 20000 إلى 25000 جين.

• يستخدم العلماء المصفوفات الدقيقة لتحليل نشاط الجينات في ظل ظروف مختلفة. وهي تستخدم رقائق الحمض النووي - شرائح زجاجية عليها آلاف من قطع الحمض النووي. قد تكون المعلومات مفيدة في علاج الأمراض الوراثية. يسمح تحليل المصفوفة الدقيقة للعلماء أيضًا باكتشاف اختلافات صغيرة في التسلسل الجيني للأشخاص. يأمل العلماء في استخدام هذه المعلومات لتطوير علاجات فردية.

• الأجزاء الكبيرة من حمضنا النووي هي نفسها الموجودة في الكائنات الحية الأخرى. كلما اقتربت العلاقة التطورية ، زاد الجزء المشترك من الحمض النووي بيننا.

1. وصف بنية الحمض النووي. ص. 434

2. اشرح سبب أهمية الاقتران القاعدي التكميلي لتكرار الحمض النووي بدقة. ص. 435

3. لماذا يوصف استنساخ الحمض النووي بأنه شبه محافظ؟ ص. 436

4. شرح أدوار النسخ والترجمة في تحويل رسالة الحمض النووي إلى بروتين. ص.436 - 437

5. ما هي الطرق التي يختلف فيها الحمض النووي الريبي عن الحمض النووي؟ ص 436 - 437

6. ما هي الأدوار التي تلعبها mRNA و tRNA و rRNA في تخليق البروتين؟ ص. 437

7. تعريف الكودون. ما الدور الذي تلعبه الكودونات في تخليق البروتين؟ ص. 438

8. ما هو دور Anticodon؟ ص.438 - 439

9. وصف الأحداث التي تحدث أثناء بدء تخليق البروتين واستطالة سلسلة البروتين وانتهاء التخليق. ص 439 - 441

10. لماذا يكون للحذف تأثير كبير على الخلية؟ ص 441-442

11. كيف يتم تنظيم نشاط الجينات؟ ص. 442

12. تعريف الهندسة الوراثية. اشرح أدوار إنزيمات التقييد والنواقل في الهندسة الوراثية. ص 442 - 445

13. وصف بعض الطرق التي استخدمت بها الهندسة الوراثية في الزراعة والطب. ص 445 - 450

14. ما هو العلاج الجيني؟ ص 448 - 450

15. القاعدة التكميلية للثيمين هي

16. على الرغم من أن كمية أي قاعدة معينة في الحمض النووي ستختلف بين الأفراد ، فإن كمية الجوانين ستساوي دائمًا كمية

ب. مرنا مكمل لخيط قالب من الحمض النووي.

ج. الحمض الريبي النووي النقال مكمل لـ mRNA.

19. يقع Anticodon على جزيء _____.

20. في الحمض النووي الريبي ، يرتبط النيوكليوتيدات _____ بالأدينين.

21. في الهندسة الوراثية ، يتم إجراء التخفيضات المتداخلة في الحمض النووي التي تسمح بتقسيم الجينات معًا بواسطة ____.

استخدم الكود الجيني في الشكل 21.5 (ص 438) للإجابة على السؤالين 1 و 2.

1. ماذا سيكون تسلسل الأحماض الأمينية في عديد الببتيد الناتج عن حبلا من الرنا المرسال مع التسلسل الأساسي التالي؟

2. فيما يلي تسلسلات أساسية في أربعة سلاسل من الرنا المرسال: واحد طبيعي وثلاثة مع طفرات. (ضع في اعتبارك أن الترجمة تبدأ بكودون البداية وتنتهي برمز التوقف.) أي من التسلسلات المتحولة من المحتمل أن يكون لها أشد التأثيرات؟ لماذا ا؟ أيهما سيكون له أقل التأثيرات خطورة؟ لماذا ا؟

مرنا عادي: AUG ACA UAU GAG ACG ACU

الطفرة 1: AUG ACC UAC GAA ACG ACC

الطفرة 2: AUG ACU UAA GAG ACG ACA

الطفرة 3: AUG ACG UAU GAG ACG ACG

3. أنت محقق في مسرح جريمة تدلي بشهادتك في محاكمة قتل. بصمات الحمض النووي الموضحة على اليمين هي تلك الخاصة ببقع الدم في مسرح الجريمة (وليس دم الضحية) وبصمات سبعة مشتبه بهم (مرقّمون من 1 إلى 7). دم أي مشتبه به يطابق بقعة الدم من مسرح الجريمة؟

أن تصبح متعلما بالمعلومات

صف بعض الاستخدامات الطبية الممكنة للمعلومات المكتسبة من مشروع الجينوم البشري. ما هي القضايا الأخلاقية التي يثيرها المشروع؟ استخدم ثلاثة مصادر موثوقة على الأقل (المجلات والكتب والمواقع الإلكترونية) للإجابة على هذه الأسئلة. اشرح سبب اختيارك لتلك المصادر.

1 سنقوم بتطوير هذا المفهوم مع تقدم الفصل. ترمز بعض الجينات إلى عديد ببتيد هو جزء فقط من بروتين وظيفي. يمكن للجين أيضًا ترميز RNA الذي يشكل جزءًا من الريبوسوم أو الذي ينقل الأحماض الأمينية أثناء تخليق البروتين.

2 يبدو أن البلازميدات قد تطورت كوسيلة لنقل الجينات بين البكتيريا. يمكن للبلازميد أن ينسخ نفسه ويمرر بجيناته إلى بكتيريا أخرى.

إذا كنت صاحب حقوق الطبع والنشر لأي مادة واردة على موقعنا وتعتزم إزالتها ، فيرجى الاتصال بمسؤول الموقع للحصول على الموافقة.


GENMARK: التعرف الجيني الموازي لكل من خيوط الحمض النووي ☆

إن مشكلة التنبؤ بمواقع الجينات في الحمض النووي المتسلسل حديثًا معروفة جيدًا ولكنها لا تزال بعيدة عن الحل بنجاح. تم اقتراح نهج جديد للمشكلة يعتمد على نماذج سلسلة ماركوف المعتمدة على الإطار (غير المتجانسة) لمناطق ترميز البروتين. هذا النهج هو ، على ما يبدو ، أحد أقوى طرق "البحث حسب المحتوى". تجمع الفكرة الأولية للطريقة بين نماذج ماركوف المحددة لمنطقة الترميز وغير المشفرة جنبًا إلى جنب مع وظيفة صنع القرار Bayes & # x27 وتسمح بالتعميم السهل لاستخدام نماذج سلسلة Markov ذات الترتيب الأعلى. يسمح التعميم الآخر الموصوف في هذه المقالة بتحليل كل من خيوط الحمض النووي في وقت واحد. تقوم طرق البحث الجيني المعروفة حاليًا بتحليل شريطي الحمض النووي بالتناوب ، واحدًا تلو الآخر. عند القيام بذلك ، تفشل جميع الطرق المعروفة بمعنى أنها تولد إشارات تنبؤ خاطئة (مصطنعة) للخيط المعين عندما تكون منطقة التشفير الحقيقية موجودة على خيط الحمض النووي التكميلي. يتم تجنب هذا العيب الشائع من خلال استخدام خوارزمية بايز التي تستخدم نموذج سلسلة ماركوف غير متجانس إضافي لـ "ظل" منطقة التشفير - التسلسل المكمل لتسلسل تشفير البروتين.

تم تقديم النسخة الأولية من هذا العمل خلال ورشة العمل الدولية الثانية للمشاكل المفتوحة في علم الأحياء الجزيئي الحسابي، مركز تيلورايد الصيفي للبحوث ، تيلورايد ، كولورادو ، 19 يوليو - 2 أغسطس ، 1992.


Samacheer Kalvi 12th Bio Zoology Molecular Genetics Text Book Back الأسئلة والأجوبة

السؤال رقم 1.
أظهرت تجربة هيرشي وتشيس مع العاثية ذلك
(أ) يدخل البروتين الخلايا البكتيرية
(ب) الحمض النووي هو المادة الجينية
(ج) يحتوي الحمض النووي على كبريت مشع
(د) تخضع الفيروسات للتحول
إجابة:
(ب) الحمض النووي هو المادة الجينية

السؤال 2.
DNA و RNA متشابهان فيما يتعلق بـ
(أ) الثايمين كقاعدة نيتروجين
(ب) شكل حلزون واحد تقطعت به السبل
(ج) النوكليوتيدات المحتوية على السكريات وقواعد النيتروجين والفوسفات
(د) نفس تسلسل النيوكليوتيدات للحمض الأميني فينيل ألانين
إجابة:
(ج) النوكليوتيدات المحتوية على السكريات وقواعد النيتروجين والفوسفات

السؤال 3.
يتم إنتاج جزيء mRNA بواسطة
(أ) النسخ المتماثل
(ب) النسخ
(ج) الازدواجية
(د) الترجمة
إجابة:
(ب) النسخ

السؤال 4.
يقدر العدد الإجمالي للقواعد النيتروجينية في الجينوم البشري بحوالي
(أ) 3.5 مليون
(ب) 35000
(ج) 35 مليون
(د) 3.1 مليار
إجابة:
(د) 3.1 مليار

السؤال 5.
يتم نقل خلايا الإشريكية القولونية التي تنمو على وسط 15N إلى وسط 14N وتركها تنمو لمدة جيلين. يتم فصل الحمض النووي المستخرج من هذه الخلايا بشكل فائق في تدرج كثافة كلوريد السيزيوم. ما كثافة توزيع الحمض النووي التي تتوقعها في هذه التجربة؟
(أ) نطاق واحد مرتفع وواحد منخفض الكثافة
(ب) نطاق كثافة وسيطة واحد
(ج) نطاق كثافة عالية وواحد وسيط
(د) نطاق كثافة منخفض وواحد وسيط
إجابة:
(د) نطاق كثافة منخفض وواحد وسيط

السؤال 6.
ما هو أساس الاختلاف في تخليق الشريط الرئيسي والمتأخر من جزيئات الحمض النووي؟
(أ) يحدث أصل النسخ المتماثل فقط عند الطرف الخامس للجزيئات
(ب) يعمل DNA ligase فقط في اتجاه 3 '→ 5'
(ج) يمكن لبوليميراز الحمض النووي أن ينضم إلى نيوكليوتيدات جديدة فقط في الطرف الثالث من المنصة المتنامية
(د) Helicases وبروتينات الربط أحادية السلسلة التي تعمل في نهاية 5
إجابة:
(د) Helicases وبروتينات الربط أحادية السلسلة التي تعمل في نهاية 5

السؤال 7.
أي مما يلي هو التسلسل الصحيح للحدث بالإشارة إلى العقيدة المركزية؟
(أ) النسخ والترجمة والنسخ
(ب) النسخ والنسخ والترجمة
(ج) النسخ والترجمة والنسخ
(د) النسخ والنسخ والترجمة
إجابة:
(د) النسخ والنسخ والترجمة

السؤال 8.
أي من العبارات التالية غير صحيحة حول تكرار الحمض النووي؟
(أ) يحدث فك جزيء الحمض النووي عندما تنكسر روابط الهيدروجين
(ب) يحدث النسخ المتماثل حيث يتم إقران كل قاعدة بأخرى مثلها تمامًا
(ج) تُعرف العملية باسم النسخ المحافظ شبه & # 8211 لأنه يتم حفظ خيط قديم واحد في الجزيء الجديد
(د) تقام أزواج القاعدة التكميلية مع روابط هيدروجينية
إجابة:
(ب) يحدث النسخ المتماثل حيث يتم إقران كل قاعدة بأخرى مثلها تمامًا

السؤال 9.
أي من العبارات التالية غير صحيح بشأن تكرار الحمض النووي في حقيقيات النوى؟
(أ) يبدأ النسخ المتماثل في أصل واحد للنسخ المتماثل.
(ب) النسخ المتماثل ثنائي الاتجاه من الأصول.
(ج) يحدث النسخ المتماثل بحوالي مليون زوج أساسي في الدقيقة.
(د) هناك العديد من الكروموسومات البكتيرية المختلفة ، مع حدوث تكرار في كل منها في نفس الوقت.
إجابة:
(د) هناك العديد من الكروموسومات البكتيرية المختلفة ، مع حدوث تكرار في كل منها في نفس الوقت.

السؤال 10.
كان أول كودون يتم فك شفرته هو الرموز الخاصة به
(أ) AAA ، البرولين
(ب) GGG ، ألانين
(ج) UUU ، فينيل ألانين
(د) TTT ، أرجينين
إجابة:
(ج) UUU ، فينيل ألانين

السؤال 11.
أثبتت تجربة ميسيلسون وستال __________
(أ) التنبيغ
(ب) التحول
(ج) الحمض النووي هو المادة الجينية
(د) الطبيعة شبه المحافظة لتكرار الحمض النووي
إجابة:
(د) الطبيعة شبه المحافظة لتكرار الحمض النووي

السؤال 12.
تتكون الريبوسومات من وحدتين فرعيتين ، الوحدة الفرعية الأصغر للريبوسوم لها موقع ربط لها والوحدة الفرعية الأكبر لها موقعان ربط لاثنين
إجابة:
مرنا ، الحمض الريبي النووي النقال

السؤال 13.
أنوبيرونيسا:
(أ) البروتين الذي يقمع التعبير الجيني
(ب) البروتين الذي يسرع التعبير الجيني
(ج) مجموعة الجينات الهيكلية ذات الوظيفة ذات الصلة
(د) الجين الذي قام بتشغيل الجينات الأخرى أو إيقاف تشغيلها
إجابة:
(د) الجين الذي قام بتشغيل الجينات الأخرى أو إيقاف تشغيلها

السؤال 14.
عندما يكون اللاكتوز موجودًا في وسط الاستزراع:
(أ) يحدث نسخ الجينات lacy ، lac z ، lac a
(ب) القامع غير قادر على الارتباط بالمشغل
(ج) القامع قادر على الارتباط بالمشغل
(د) كلا (أ) و (ب) صحيحان
إجابة:
(د) كلا (أ) و (ب) صحيحان

السؤال 15.
اذكر الأسباب: الكود الجيني "عالمي".
إجابة:
الكود الجيني عالمي. وهذا يعني أن جميع الأنظمة الحية المعروفة تستخدم الأحماض النووية وأن نفس الكودونات الأساسية الثلاثة (الكودون الثلاثي) توجه تخليق البروتين من الأحماض الأمينية. على سبيل المثال ، رموز كودون mRNA (UUU) للفينيل ألانين في جميع خلايا جميع الكائنات الحية. تم الإبلاغ عن بعض الاستثناءات في جينومات بدائية النواة والميتوكوندريا والبلاستيدات الخضراء. ومع ذلك ، فإن أوجه التشابه أكثر شيوعًا من الاختلافات.

السؤال 16.
قم بتسمية الأجزاء المميزة بعلامة "أ" و "ب" في وحدة النسخ المحددة:
إجابة:

السؤال 17.
ميِّز & # 8211 حبلا قياديًا وخيطًا متأخرًا
إجابة:

  1. بوليميراز الحمض النووي I آلية إصلاح الحمض النووي
  2. بوليميريز الحمض النووي الثاني آلية إصلاح الحمض النووي
  3. بوليميراز الدنا الثالث تشارك في نسخ الحمض النووي

السؤال 18.
تمييز & # 8211 قالب حبلا وخيط الترميز.
إجابة:

  1. قالب ستراند: أثناء النسخ المتماثل ، تعمل خصلة الحمض النووي ذات القطبية 3 "→ 5" كحبل قالب.
  2. حبلا الترميز: أثناء النسخ المتماثل ، تعمل خصلة الحمض النووي ذات القطبية 5 "→ 3" كحبل ترميز.

السؤال 19.
اذكر أي طريقتين يمكن من خلال تعدد أشكال النوكليوتيدات المفردة (SNPs) المحددة في الجينوم البشري إحداث تغيير ثوري في العلوم البيولوجية والطبية.
إجابة:
حدد العلماء حوالي 1.4 مليون موقع ، حيث تحدث الاختلافات في الحمض النووي الفردي (SNPs & # 8211 تعدد أشكال النوكليوتيدات المفردة & # 8211 تُنطق باسم "القصاصات") في البشر. يعد تحديد "SNIPS" مفيدًا في العثور على مواقع الكروموسومات للتسلسلات المرتبطة بالأمراض وتتبع التاريخ البشري.

السؤال 20.
اذكر أي ثلاثة أهداف لمشروع الجينوم البشري.
إجابة:

  1. حدد جميع الجينات (حوالي 30000) في الحمض النووي البشري.
  2. حدد تسلسل الثلاثة مليارات زوج من القواعد الكيميائية التي تشكل الحمض النووي البشري.
  3. لتخزين هذه المعلومات في قواعد البيانات.

السؤال 21.
في الإشريكية القولونية ، يتم إنتاج ثلاثة إنزيمات 0- galactosidase ، permease و transacetylase في وجود اللاكتوز. اشرح سبب عدم تصنيع الإنزيمات في غياب اللاكتوز.
إجابة:
في حالة عدم وجود اللاكتوز ، يرتبط البروتين المثبط بالمشغل ويمنع نسخ الجين الهيكلي بواسطة بوليميريز RNA ، وبالتالي لا يتم إنتاج الإنزيمات. ومع ذلك ، سيكون هناك دائمًا حد أدنى من تعبير lac operon حتى في حالة عدم وجود اللاكتوز.

السؤال 22.
يميز بين الجين الهيكلي والجين التنظيمي وجين المشغل.
إجابة:
هيكل الأوبرون: كل مشغل هو وحدة للتعبير الجيني والتنظيم ويتكون من واحد أو أكثر من الجينات الهيكلية وجين المشغل المجاور الذي يتحكم في النسخ ، نشاط الجين الهيكلي.

  1. أكواد الجينات الهيكلية للبروتينات ، الرنا الريباسي و الحمض الريبي النووي النقال التي تتطلبها الخلية.
  2. المروجين هي تسلسلات الإشارات في الحمض النووي التي تبدأ تخليق الحمض النووي الريبي. يرتبط بوليميراز الحمض النووي الريبي بالمروج قبل بدء النسخ.
  3. المشغلون موجودون بين المروجين والجينات الهيكلية. يرتبط بروتين المثبط بمنطقة المشغل في المشغل.

السؤال 23.
يحدث انخفاض مستوى التعبير عن lac operon طوال الوقت في E-coli. تبرير البيان.
إجابة:
أحد الإنزيمات التي يتم تصنيعها بواسطة أوبرون اللاكتوز هو بيرميز الذي يشارك في نقل اللاكتوز إلى الخلايا. إذا تم تعطيل أوبرون اللاكتوز ، فلن يتم تصنيع النفاذية وبالتالي لا يمكن للاكتوز دخول الخلية. يعمل اللاكتوز كمحفز ، مرتبطًا بالبروتين الكابح وتشغيل المشغل لبدء التعبير الجيني.

السؤال 24.
لماذا يسمى مشروع الجينوم البشري بالمشروع الضخم؟
إجابة:
تم إطلاق مشروع الجينوم البشري الدولي في عام 1990. وكان مشروعًا ضخمًا واستغرق إكماله 13 عامًا. الجينوم البشري أكبر بحوالي 25 مرة من جينوم أي كائن حي تم تسلسله حتى الآن وهو أول جينوم للفقاريات يتم استكماله. يقال إن الجينوم البشري يحتوي على ما يقرب من 3 و GT109 نقطة أساس. ارتبط HGP ارتباطًا وثيقًا بالتطور السريع لمجال جديد في علم الأحياء يسمى المعلوماتية الحيوية.

السؤال 25.
من فحصهم لهيكل الحمض النووي ، ماذا استنتج واتسون وكريك عن الآلية المحتملة لتكرار الحمض النووي ، والقدرة على الترميز والطفرة؟
إجابة:
استدلال Watson and Crick على تكرار الحمض النووي: خلصوا إلى أن كل خيط DNA في اللولب يعمل كقالب أثناء تكرار الحمض النووي مما يؤدي إلى تكوين جزيئات DNA ابنة جديدة ، والتي تكون مكملة للضفيرة الأبوية ، (أي طريقة شبه محافظة من الاستدلال على القدرة على الترميز: أثناء النسخ ، يتم ترميز المعلومات الجينية في خيط DNA إلى mRNA كقواعد تكميلية (باستثناء uracil بدلاً من الثايمين في RNA) الاستدلال على الطفرة: أي تغييرات في تسلسل النيوكليوتيدات للحمض النووي يؤدي إلى التغيير المقابل في تسلسل الأحماض الأمينية لبروتين معين مما يؤكد صحة الشفرة الوراثية.

السؤال 26.
لماذا يسمى الحمض الريبي النووي النقال جزيء محول؟
إجابة:
يعمل جزيء نقل الحمض النووي الريبي (tRNA) للخلية كوسيلة تلتقط الأحماض الأمينية المنتشرة عبر السيتوبلازم وتقرأ أيضًا رموزًا محددة لجزيئات الرنا المرسال. ومن ثم يطلق عليه جزيء محول. هذا المصطلح افترضه فرانسيس كريك.

السؤال 27.
ما هي الاختلافات الهيكلية الثلاثة بين RNA و DNA؟
إجابة:
الحمض النووي:

  1. السكر هو سكر ديوكسيريبوز.
  2. هيكل مزدوج تقطعت بهم السبل.
  3. قواعد النيتروجين هي Adenine و Guanine و Cytosine و Thymine.
  1. السكر سكر ريبوز.
  2. جزيء واحد تقطعت به السبل.
  3. قواعد النيتروجين هي Adenine و Guanine و Cytosine و Uracil.

السؤال 28.
قم بتسمية anticodon المطلوب للتعرف على الكودونات التالية:
AAU و CGA و UAU و GCA.
إجابة:
UUA و GCU و AUA و CGU.

السؤال 29.
(أ) حدد الشكل الوارد أدناه
(ب) إعادة رسم الهيكل كشوكة مكررة وتسمية الأجزاء
(ج) اكتب مصدر الطاقة لهذا النسخ المتماثل وقم بتسمية الإنزيم المتضمن في هذه العملية.
(د) اذكر الاختلافات في تركيب البروتين ، بناءً على قطبية خيوط القالب.
إجابة:
(أ) شوكة النسخ المتماثل
(ب)

(ج) ديوكسي نيوكليوتيد ، يعمل ثلاثي الفوسفات كمصدر للطاقة للتكرار. يستخدم بوليميريز الحمض النووي للتكرار
(د) سيتم تطوير معلومات اتصال mRNA لتخليق البروتين من خيوط DNA ذات Polariy 5 '→ 3'

السؤال 30.
إذا كان تسلسل الترميز في وحدة النسخ مكتوبًا على النحو التالي:
5 "TGCATGCATGCATGCATGCATGCATGC 3"
اكتب تسلسل الرنا المرسال.
إجابة:
تسلسل mRNA هو 3’ACGUACGUACGUUCGUACGUACGUACG5 "

السؤال 31.
كيف تكون عملية تصنيع البروتين ذات المرحلتين مفيدة؟
إجابة:
تكاد تكون السمة الجينية المنقسمة للجينات حقيقية النواة غائبة تمامًا في بدائيات النوى. في الأصل ، قد يكون كل exon مشفرًا لسلسلة بولي ببتيد واحدة بوظيفة محددة. نظرًا لأن ترتيب exon وإزالة intron مرنان ، فإن تشفير exon لهذه الوحدات الفرعية متعددة الببتيد يعمل كمجالات تجمع بطرق مختلفة لتشكيل جينات جديدة. يمكن للجينات المفردة أن تنتج بروتينات وظيفية مختلفة عن طريق ترتيب exons لها بعدة طرق مختلفة من خلال أنماط التضفير البديلة ، وهي آلية معروفة بأنها تلعب دورًا مهمًا في توليد كل من البروتين والتنوع الوظيفي في الحيوانات. كانت الإنترونات قد نشأت قبل أو بعد تطور الجين حقيقيات النوى.

إذا ظهرت الإنترونات في وقت متأخر فكيف دخلت الجين حقيقيات النوى؟ الإنترونات عبارة عن تسلسلات DNA متحركة يمكنها أن تنفصل عن "مواقع مستهدفة" محددة تعمل كعناصر تشبه الينقولات المتحركة (التي تتوسط في نقل الجينات بين الكائنات الحية & # 8211 Horizontal Gene Transfer & # 8211 HGT). يحدث HGT بين سلالات الخلايا بدائية النواة ، أو من الخلايا بدائية النواة إلى الخلايا حقيقية النواة وبين الخلايا حقيقية النواة. يُفترض الآن أن HGT قد لعبت دورًا رئيسيًا في تطور الحياة على الأرض.

السؤال 32.
لماذا استخدم هيرشي وتشيس الفوسفور والكبريت المسمى إشعاعياً فقط؟ هل سيحصلون على نفس النتيجة إذا استخدموا الكربون والنيتروجين الموسومين إشعاعيًا؟
إجابة:
تحتوي البروتينات بشكل عام على الكبريت ولكن لا تحتوي على الفوسفور والحمض النووي (DNA) ، الفوسفور ولكن لا يحتوي على الكبريت. ومن ثم استخدم Hershey & # 8211 Chase النظائر المشعة للكبريت (3 5 S) والفوسفور (32 P) لمتابعة مسار البروتين الفيروسي والحمض النووي في وسط المزرعة. لا يمكن تحقيق النتيجة المتوقعة ، إذا تم استخدام الكربون المشع والنيتروجين ، لأن هذه الجزيئات موجودة في كل من الحمض النووي والبروتينات.

السؤال 33.
اشرح تكوين الجسيم النووي.
إجابة:
اقترح Komberg نموذجًا للنيوكليوسوم ، حيث يتم تنظيم جزيئين من بروتينات الهيستون الأربعة H2A و H2B و H3 و H4 لتشكيل وحدة من ثمانية جزيئات تسمى هيستون أوكتامير.

يتم لف الحمض النووي المشحون سالبًا حول أوكتامير هيستون موجب الشحنة لتشكيل بنية تسمى nucleosome. يحتوي النوكليوسوم النموذجي على 200 نقطة أساس من حلزون الحمض النووي. تكون أوكتاميرات الهيستون على اتصال وثيق ويتم لف الحمض النووي على السطح الخارجي للنيوكليوسوم.

السؤال 34.
ثبت أن الحمض النووي الريبي هو أول مادة وراثية. تبرير إبداء الأسباب.
إجابة:
اقترح ثلاثة علماء أحياء جزيئية في أوائل الثمانينيات (ليزلي أورجيل وفرانسيس بريك وكارل ووز) بشكل مستقل "عالم الحمض النووي الريبي" كمرحلة أولى في تطور الحياة ، وهي المرحلة التي يحفز فيها الحمض النووي الريبي جميع الجزيئات اللازمة للبقاء والتكاثر. مصطلح "عالم الحمض النووي الريبي" الذي استخدمه والتر جيلبرت لأول مرة في عام 1986 ، يفترض أن الحمض النووي الريبي هو أول جيني على وجه الأرض. توجد الآن أدلة كافية تشير إلى أن عمليات الحياة الأساسية (مثل التمثيل الغذائي والترجمة والربط وما إلى ذلك) قد تطورت حول الحمض النووي الريبي. يمتلك الحمض النووي الريبي القدرة على العمل كمواد وراثية ومحفز. هناك العديد من التفاعلات الكيميائية الحيوية في الأنظمة الحية التي يتم تحفيزها بواسطة الحمض النووي الريبي. يُعرف هذا الحمض النووي الريبي التحفيزي باسم الريبوزيم. لكن ، كون الحمض النووي الريبي محفزًا كان تفاعليًا وبالتالي غير مستقر.

أدى ذلك إلى تطور شكل أكثر استقرارًا من الحمض النووي ، مع بعض التعديلات الكيميائية. نظرًا لأن الحمض النووي عبارة عن جزيء مزدوج تقطعت به السبل وله حبلا تكميليًا ، فقد قاوم التغييرات من خلال تطوير عملية الإصلاح. تعمل بعض جزيئات الحمض النووي الريبي كمنظم للجينات من خلال الارتباط بالحمض النووي والتأثير على التعبير الجيني. تستخدم بعض الفيروسات الحمض النووي الريبي كمادة وراثية. كان رأي أندرو فاير وكريغ ميلو (الحاصلين على جائزة نوبل في عام 2006) أن الحمض النووي الريبي هو عنصر نشط في كيمياء الحياة.

Samacheer Kalvi 12th Bio Zoology Molecular Genetics أسئلة وأجوبة إضافية

السؤال رقم 1.
مصطلح "جين" صاغه ___________
إجابة:
فيلهلم جوهانسن

السؤال 2.
من التجربة التي قدمت أخيرًا دليلًا مقنعًا على أن الحمض النووي هو المادة الجينية؟
(أ) تجربة جريفيث
(ب) تجربة أفيري وماكلويد وماكارتي
(ج) تجربة هيرشي تشيس
(د) تجربة أوري ميلر
إجابة:
(ج) تجربة هيرشي تشيس

السؤال 3.
في تجربة Hershey & # 8211 Chase ، تم جعل الحمض النووي لمرحلة T 2 مشعًا باستخدام ___________
(أ) 32 ص
(ب) 32 ق
(ج) 35 ص
(د) 32 ق
إجابة:
(أ) 32 ص

السؤال 4.
يتكون النيوكليوسيد من ___________
(أ) السكر والفوسفات
(ب) قاعدة النيتروجين والفوسفات
(ج) قاعدة السكر والنيتروجين
(د) السكر والفوسفات والنيتروجين
إجابة:
(ج) قاعدة السكر والنيتروجين

السؤال 5.
تحديد العبارة غير الصحيحة
(أ) القاعدة هي مادة تقبل H + أيون
(ب) لكل من DNA و RNA أربعة قواعد
(ج) البيورينات لها حلقة كربون-نيتروجين واحدة
(د) الثايمين فريد من نوعه للحمض النووي
إجابة:
(ج) البيورينات لها حلقة كربون-نيتروجين واحدة

السؤال 6.
اقترح Watson and Crick نموذج الحمض النووي الحلزوني المزدوج الخاص بهما بناءً على تحليل حيود الأشعة السينية في ___________
(أ) اروين تشارجاف
(ب) ميسلسون وستال
(ج) ويلكينز وفرانكلين
(د) جريفيث
إجابة:
(ج) ويلكينز وفرانكلين

السؤال 7.
تم استخدام مصطلح "عالم RNA" لأول مرة بواسطة ___________
إجابة:
والتر جيلبرت

السؤال 8.
المسافة بين زوجي قاعدتين متتاليتين في الحمض النووي هي ___________
(أ) 0.34 نانومتر
(ب) 3.4 نانومتر
(ج) 0.034 نانومتر
(د) 34 نانومتر
إجابة:
(أ) 0.34 نانومتر

السؤال 9.
إذا كان طول E. coli DNA 1.36 مم ، فإن عدد أزواج القاعدة هو ___________
(أ) 0.36 × 10 6 م
(ب) 4 × 10 6 م
(ج) 0.34 × 10-9 نانومتر
(د) 4 × 10 - 9 م
إجابة:
(ب) 4 × 10 6 م

السؤال 10.
تحديد التسلسل الصحيح في تنظيم كروموسوم حقيقيات النوى.
(أ) نوكليوسوم & # 8211 الملف اللولبي & # 8211 كروماتيد
(ب) كروماتيد & # 8211 نوكليوسوم & # 8211 الملف اللولبي
(ج) الملف اللولبي & # 8211 الكروماتين & # 8211 DNA
(د) نوكليوسوم & # 8211 ملف لولبي & # 8211 جينوفور
إجابة:
(أ) نوكليوسوم & # 8211 الملف اللولبي & # 8211 كروماتيد

السؤال 11.
التأكيد (أ): يلاحظ Genophore في بدائيات النوى.
السبب (ص): تمتلك البكتيريا DNA دائريًا بدون تنظيم الكروماتين.
(أ) كلا من A و R صحيحان
(ب) A صحيح R غير صحيح
(ج) R يوضح A
(د) A غير صحيح R صحيح
إجابة:
(ج) R يوضح A

السؤال 12.
التأكيد (أ): الهيتروكروماتين نشط نسبيًا.
السبب (ص): كروماتين معبأ بإحكام والذي يترك بقع داكنة.
(أ) كلا من A و R صحيحان
(ب) A صحيح R غير صحيح
(ج) R يوضح A
(د) A غير صحيح R صحيح
إجابة:
(د) A غير صحيح R صحيح

السؤال 13.
التأكيد (أ): تم اقتراح نموذج شبه متحفظ من قبل هيرشي وتشيس.
السبب (R): يحتوي DNA الابنة على خيوط جديدة فقط.
(أ) كلا من A و R غير صحيحين
(ب) A صحيح R غير صحيح
(ج) R يوضح A
(د) A غير صحيح R صحيح
إجابة:
(أ) كلا من A و R غير صحيحين

السؤال 14.
يسمى إنزيم كومبرج باسم _____
إجابة:
بوليميريز الحمض النووي أنا

السؤال 15.
يحدث تكرار الحمض النووي في __________ مرحلة دورة الخلية.
(صباحا
(ب) S.
(ج) G1
(د) G2
إجابة:
(ب) S.

السؤال 16.
تم إثبات نموذج النسخ شبه المحافظ بواسطة __________
(أ) هيرشي وتشيس
(ب) جريفيث
(ج) ميسلسون وستال
(د) ماكلويد وماكارتي
إجابة:
(ج) ميسلسون وستال

السؤال 17.
كم عدد أنواع بوليميرات الحمض النووي التي تمتلكها خلية حقيقية النواة؟
(أ) اثنان
(ب) ثلاثة
(ج) أربعة
(د) خمسة
إجابة:
(د) خمسة

السؤال 18.
تحديد العبارة غير الصحيحة
(أ) يحدث النسخ المتماثل في موقع ori & # 8211 للحمض النووي
(ب) يعمل ديوكسي نيوكليوتيد ثلاثي الفوسفات كركيزة
(ج) يتم تفكيك خيط DNA بواسطة topoisomerase
(د) يحفز بوليميراز الحمض النووي البلمرة عند 3-OH
إجابة:
(ج) يتم تفكيك خيط DNA بواسطة topoisomerase

السؤال 19.
تسمى الأجزاء المركبة بشكل متقطع من الخيط المتأخر ________
إجابة:
شظايا أوكازاكي

السؤال 20.
تمتلك الفيروسات القهقرية ________ كمادة وراثية.
إجابة:
RNA

السؤال 21.
ما الذي لا يعد جزءًا من وحدة النسخ؟
(أ) المروج
(ب) المشغل
(ج) الجين الإنشائي
(د) المنهي
إجابة:
(ب) المشغل

السؤال 22.
Goldberg & # 8211 Hogness box of eukaryotes تعادل ________ من بدائيات النوى.
إجابة:
مربع Pribnow

السؤال 23.
شظايا أوكازاكي ينضم إليها الإنزيم ________ أثناء تكاثر الحمض النووي.
إجابة:
ligase DNA

السؤال 24.

إجابة:
(أ) A & # 8211 iv، B & # 8211 i، C & # 8211 ii، D & # 8211 iii

السؤال 25.
يرتبط بوليميراز الحمض النووي الريبي بدائيات النوى بعامل لبدء البلمرة.
(أ) رو
(ب) ثيتا
(ج) سيجما
(د) psi
إجابة:
(ج) سيجما

السؤال 26.

(أ) السد
(ب) المخلفات
(ج) الربط
(د) النسخ
إجابة:
(ج) الربط

السؤال 27.
أي من الميزات التالية غائبة في بدائيات النوى؟
(أ) تمتلك بدائيات النوى ثلاثة أنواع رئيسية من الحمض النووي الريبي
(ب) الجينات الهيكلية متعددة النوى
(ج) تتطلب عملية بدء النسخ عامل "P"
(د) ميزة الجينات المنقسمة
إجابة:
(د) ميزة الجينات المنقسمة

السؤال 28.
أي من التسلسل التالي تمت ترجمته بالكامل؟
(ط) AGA و UUU و UGU و AGU و UAG
(2) أغسطس ، UUU ، AGA ، UAC ، UAA
(3) AAA و UUU و UUG و UGU و UGA
(4) أغسطس ، AAU ، AAC ، UAU ، UAG
(أ) الأول والثاني
(ب) ثانيا فقط
(ج) الأول والثالث
(د) الثاني والرابع
إجابة:
(د) الثاني والرابع

السؤال 29.
تغطية mRNA يحدث باستخدام __________
(أ) بقايا بولي أ
(ب) ميثيل غوانوزين ثلاثي الفوسفات
(ج) ديوكسي ريبونوكليوتيد ثلاثي الفوسفات
(د) ريبونوكليوتيد ثلاثي الفوسفات
إجابة:
(ب) ميثيل غوانوزين ثلاثي الفوسفات

السؤال 30.
أحد الجوانب ليست سمة من سمات الكود الجيني؟
(محدد
(ب) منحط
(ج) عالمي
(د) غامض
إجابة:
(د) غامض

السؤال 31.
أي من الكودون الثلاثي ليس رمز البرولين؟
(ط) CCU
(2) CAU
(ثالثا) CCG
(رابعا) هيئة الطيران المدني
(أ) أنا فقط
(ب) الثاني والرابع
(ج) ثالثا فقط
(د) كل ما سبق
إجابة:
(ب) الثاني والرابع

السؤال 32.
تسمى تسلسلات الترميز الموجودة في الجينات المنقسمة.
(أ) عوامل التشغيل
(ب) الإنترونات
(ج) Exons
(د) سيسترون
إجابة:
(ج) Exons

السؤال 33.
أي من الرنا المرسال التالي ينتج 6 أحماض أمينية بعد الترجمة؟
(ط) UCU UAU AGU CGA UGC AGU UGA AAA UUU
(2) UGA AGA UAG GAG CAU CCC UAC UAU GAU
(3) GUC UGC UGG GCU GAU UAA AGG AGC AUU
(4) AUG UAC CAU UGC UGA UGC AGG AGC CCG
إجابة:
(ط) UCU UAU AGU CGA UGC AGU UGA AAA UUU

السؤال 34.
عامل إنهاء النسخ المرتبط بـ RNA polymerase في بدائيات النوى هو
(أ) θ
(ب) σ
(ج) ρ
(د) ∑
إجابة:
(ج) ρ

السؤال 35.
في الخيط المزدوج للحمض النووي ، إذا كانت نسبة الجوانين 30٪ ، فما هي نسبة الثايمين؟
(أ) 100٪
(ب) 20٪
(ج) 10٪
(د) 70٪
إجابة:
(ب) 20٪

السؤال 36.
حدد الأزواج الثلاثية التي ترمز إلى Tyrosine
(أ) UUU ، UUC
(ب) UAU، UAU
(ج) UGC، UGU
(د) CAU، CAC
إجابة:
(ب) UAU، UAU

السؤال 37.

إجابة:
A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii

السؤال 38.
كود AUG لـ __________
(أ) أرجينين
(ب) تيروزين
(ج) التربتوفان
(د) الميثيونين
إجابة:
(د) الميثيونين

السؤال 39.
تسلسل القواعد في خيط ترميز الحمض النووي هو G A G T T A G C A G G C ، ثم تسلسل الكودونات في النسخة الأولية هو
(أ) C U C A U A C G C C C G
(ب) C U C A A U C G U C C G
(ج) U C A G A U C U G C G C
(د) U U C A A U C G U G C G
إجابة:
(ب) C U C A A U C G U C C G

السؤال 40.
منطقة مروج حقيقيات النوى هي __________
(أ) تاتا
(ب) أغسطس
(ج) UUUGA
(د) AAAAU
إجابة:
(أ) تاتا

السؤال 41.
تطابق ما يلي:
(أ) أغسطس & # 8211 (ط) التيروزين
(ب) UGA & # 8211 (2) جلايسين
(C) UUU & # 8211 (iii) ميثيونين
(د) GGG & # 8211 (رابعا) فينيل ألانين
(أ) A & # 8211 iii B & # 8211 i C & # 8211 iv D & # 8211 ii
(ب) A & # 8211 iii B & # 8211 ii C & # 8211 i D & # 8211 iv
(ج) A & # 8211 iv B & # 8211 i C & # 8211 iii D & # 8211 ii
(د) A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii
إجابة:
(د) A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii

السؤال 42.
__________ عدد الكودونات ، أكواد السيستين.
إجابة:
اثنين

السؤال 43.
في فقر الدم المنجلي ، يتم تعديل __________ كودون β & # 8211 جين غلوبين.
(أ) الثامن
(ب) السابع
(ج) السادس
(د) تسعين
إجابة:
(ج) السادس

السؤال 44.
انتقاء البيان غير الصحيح.
(أ) يعمل الحمض الريبي النووي النقال كجزيء محول
(ب) لا تحتوي أكواد الإيقاف على الحمض الريبي النووي النقال
(ج) تؤدي إضافة الأحماض الأمينية إلى التحلل المائي للـ tRNA
(د) يحتوي الحمض الريبي النووي النقال (tRNA) على أربع حلقات رئيسية
إجابة:
(ج) تؤدي إضافة الأحماض الأمينية إلى التحلل المائي للـ tRNA

السؤال 45.
أي من المضادات الحيوية التالية يمنع التفاعل بين الحمض الريبي النووي النقال (الرنا الريباسي) و الرنا المرسال؟
(أ) نيومايسين
(ب) الستربتومايسين
(ج) التتراسيكلين
(د) الكلورامفينيكول
إجابة:
(أ) نيومايسين

السؤال 47.
تسمى مجموعة الجينات ذات الوظيفة ذات الصلة _________
(أ) سيسترون
(ب) مشغل
(ج) لحم الخنزير
(د) ريكون
إجابة:
(ب) مشغل

السؤال 48.
يرتبط بروتين مثبط لأوبيرون لاك بـ __________ من الأوبرون.
(أ) منطقة المروج
(ب) منطقة المشغل
(ج) منطقة فاصل
(د) المنطقة المحرضة
إجابة:
(ب) منطقة المشغل

السؤال 49.
رموز الجينات Lac Z لـ __________
(أ) Permease
(ب) ترانس أسيتيلاز
(ج) بيتا-جالاكتوزيداز
(د) Aminoacyl transferase
إجابة:
(ج) بيتا-جالاكتوزيداز

السؤال 50.
تم اقتراح نموذج لاك أوبيرون من قبل __________
إجابة:
يعقوب ومونود

السؤال 51.
العدد التقريبي للزوج الأساسي في الجينوم البشري هو __________
إجابة:
3 × 10 9 بي بي

السؤال 52.
تم تطوير تسلسل الحمض النووي الآلي بواسطة.
إجابة:
فريدريك سانجر

السؤال 53.
أي من الكروموسوم لديه كثافة جينية أعلى؟
(أ) الكروموسوم 20
(ب) الكروموسوم 19
(ج) الكروموسوم 13
(د) الكروموسوم Y
إجابة:
(ب) الكروموسوم 19

السؤال 54.
عدد الجينات الموجودة في الكروموسوم Y هو __________
(أ) 2968
(ب) 213
(ج) 2869
(د) 231
إجابة:
(د) 231

السؤال 55.
كم عدد الجينات الهيكلية الموجودة في lac operon لـ E.Coli؟
(أ) 4
(ب) 3
(ج) 2
(د) 1
إجابة:
(ب) 3

السؤال 56.
تم تطوير تقنية البصمة DNA بواسطة
(أ) يعقوب ومونود
(ب) أليك جيفريز
(ج) فريدريك سانجر
إجابة:
(ب) أليك جيفريز

السؤال 57.
في بصمة الحمض النووي ، يتم فصل أجزاء الحمض النووي بواسطة __________
(أ) الطرد المركزي
(ب) الكهربائي
(ج) حيود الأشعة السينية
(د) التمسخ
إجابة:
(ب) الكهربائي

السؤال 58.
SNP تعني
(أ) تعدد أشكال النوكليوتيدات المفردة
(ب) بولي ببتيد أحادي النوكليوزيد
(ج) تعدد الأشكال النوكليوتيد الفردي
(د) بوليمر نوكليوتيد مفرد
إجابة:
(أ) تعدد أشكال النوكليوتيدات المفردة

السؤال 59.
التسلسلات المحددة من mRNA التي لم يتم ترجمتها هي __________
إجابة:
المناطق غير المترجمة (UTR)

السؤال 60.
يسمى تسلسل الحمض النووي غير المشفر أو المتدخل __________

السؤال 61.
_______ الإنترون هو مونومر الحمض النووي.
إجابة:
النوكليوتيدات

السؤال 62.
أي مما يلي مطابق بشكل خاطئ؟
(أ) النسخ & # 8211 نسخ المعلومات من DNA إلى RNA
(ب) ترجمة & # 8211 فك تشفير المعلومات من mRNA إلى البروتين
(ج) النسخ المتماثل & # 8211 صنع نسخ الحمض النووي
(د) الربط & # 8211 ربط exons مع introns
إجابة:
(د) الربط & # 8211 ربط exons مع introns

السؤال رقم 1.
من اقترح جينًا واحدًا & # 8211 فرضية إنزيم واحد؟ تعريفه.
إجابة:
اقترح جورج بيدل وإدوارد تاتوم جينًا واحدًا & # 8211 فرضية إنزيم واحدة تنص على أن جينًا واحدًا يتحكم في إنتاج إنزيم واحد.

السؤال 2.
التفريق بين النيوكليوسيد والنيوكليوتيدات.
إجابة:

  1. نوكليوزيد: تتكون الوحدة الفرعية للنيوكليوزيد من قواعد نيتروجينية مرتبطة بجزيء سكر البنتوز.
  2. النوكليوتيدات: تتكون الوحدة الفرعية للنيوكليوتيدات من قواعد نيتروجينية وسكر بنتوز ومجموعة فوسفات.

السؤال 3.
اذكر الاختلافات الرئيسية بين DNA و RNA.
إجابة:
الحمض النووي:

  1. يتكون الحمض النووي من سكر الديوكسيريبوز.
  2. القواعد النيتروجينية للحمض النووي هي: Adenine و Guanine و Cytosine و Thymine.
  1. يتكون الحمض النووي الريبي من سكر الريبوز.
  2. القواعد النيتروجينية للحمض النووي الريبي هي Adenine و Guanine و Cytosine و Uracil.

السؤال 4.
أشر إلى القواعد النيتروجينية للحمض النووي الريبي.
إجابة:
الأدينين والجوانين والسيتوزين واليوراسيل.

السؤال 5.
ما الذي يجعل الحمض النووي والحمض النووي الريبي جزيئات حمضية؟
إجابة:
مجموعة الفوسفات الوظيفية (PO4) يعطي DNA و RNA خاصية الحمض عند درجة الحموضة الفسيولوجية ، ومن هنا جاء اسم الحمض النووي.

السؤال 6.
أي نوع من السندات يتكون

  1. بين قاعدة البيورين وبيريميدين؟
  2. بين سكر البنتوز والنيوكليوتيدات المجاورة؟
  1. ترتبط قواعد البيورين والبيريميدين بروابط هيدروجينية.
  2. يرتبط سكر البنتوز بالنيوكليوتيدات المجاورة بواسطة روابط الفوسفوديستر.

السؤال 7.
يعمل الحمض النووي كمواد وراثية لغالبية الكائنات الحية وليس الحمض النووي الريبي. إعطاء أسباب لدعم البيان.
إجابة:

  1. كان الحمض النووي الريبي تفاعليًا وبالتالي غير مستقر للغاية.
  2. تعمل بعض جزيئات الحمض النووي الريبي كمنظم للجينات عن طريق الارتباط بالحمض النووي وتؤثر على التعبير الجيني.
  3. Uracil of RNA أقل استقرارًا من ثايمين الحمض النووي.

السؤال 8.
قم بتسمية أي فيروسين مادتهما الوراثية هي RNA.
إجابة:

السؤال 9.
ما هي الخصائص التي يجب أن يمتلكها الجزيء ليعمل كمادة وراثية؟
إجابة:

  1. النسخ الذاتي
  2. مخزن المعلومات
  3. استقرار
  4. الاختلاف من خلال الطفرة

السؤال 10.
كم عدد أزواج القواعد الموجودة في دورة واحدة كاملة من حلزون الحمض النووي؟ ما المسافة بين زوجي قاعدتين متتاليتين؟
إجابة:
يوجد عشرة أزواج أساسية في كل منعطف بمسافة 0.34 × 109 م بين زوجي قاعدتين متجاورتين.

السؤال 11.
ما هو الجينوفور؟
إجابة:
في بدائيات النوى مثل الإشريكية القولونية على الرغم من عدم وجود نواة محددة ، فإن الحمض النووي لا ينتشر في جميع أنحاء الخلية. يتم الاحتفاظ بالحمض النووي (كونه سالب الشحنة) مع بعض البروتينات (التي لها شحنة موجبة) في منطقة تسمى النواة. يتم تنظيم الحمض النووي باعتباره نوويًا في حلقات كبيرة يحتفظ بها البروتين. الحمض النووي من بدائيات النوى دائري تقريبًا ويفتقر إلى تنظيم الكروماتين ، ومن ثم يُطلق عليه اسم genophore.

السؤال 12.
ما هو جسيم نووي؟ كم عدد أزواج القواعد الموجودة في النواة النموذجية؟
إجابة:
يتم لف الحمض النووي المشحون سالبًا حول أوكتامير هيستون موجب الشحنة لتشكيل بنية تسمى nucleosome. يحتوي النوكليوسوم النموذجي على 200 نقطة أساس من حلزون الحمض النووي.

السؤال 13.
قم بتوسيع وتعريف NHC
إجابة:

  1. NHC: بروتين كروموسومي غير هيستون.
  2. في حقيقيات النوى ، بصرف النظر عن بروتينات الهيستون ، يلزم وجود مجموعة إضافية من البروتينات لتعبئة الكروماتين بمستوى أعلى ويشار إليها على أنها بروتينات كروموسومية غير هيستون & # 8211.

السؤال 14.
التفريق بين الهيتروكروماتين والكروماتين الحقيقي.
إجابة:
الهيتروكروماتين:

  1. منطقة النواة حيث يتم تعبئة الكروماتين بشكل فضفاض وتسمى البقع الخفيفة بـ Heterochromatin.
  2. غير نشط نسبيًا.
  1. منطقة النواة حيث يتم تعبئة الكروماتين بإحكام والبقع الداكنة تسمى Euchromatin.
  2. نشط النسخ.

السؤال 15.
ما هو النموذج المقبول على نطاق واسع لتكرار الحمض النووي؟ من الذي أثبت ذلك؟
إجابة:
نموذج النسخ شبه المحافظ. تم إثباته من قبل Meselson و Stahl في عام 1958.

السؤال 16.
قم بتسمية المادة الكيميائية التي يطلق عليها الاسم

  1. يُعرف DNA polymerase I أيضًا باسم إنزيم Komberg.
  2. يُعرف أيضًا Polynucleotide phosphorylase باسم إنزيم Ochoa.

السؤال 17.
قم بتسمية الأنواع المختلفة لبوليميراز DNA بدائية النواة. اذكر دورهم في عملية النسخ المتماثل.
إجابة:

  1. بوليميراز الحمض النووي I Involver في آلية إصلاح الحمض النووي
  2. بوليميراز الحمض النووي II Involver في آلية إصلاح الحمض النووي
  3. بوليميراز الدنا الثالث Involver في تكرار الحمض النووي

السؤال 18.
ما هي وظيفة ديوكسي نيوكليوتيد ثلاثي الفوسفات في النسخ المتماثل؟
إجابة:
يعمل نوكليوتيد ثلاثي الفوسفات كركيزة ويوفر أيضًا طاقة لتفاعل البلمرة.

السؤال 19.
فيما يلي بعض أحداث تكاثر حقيقيات النوى. قم بتسمية الإنزيمات المشاركة في العملية.

  1. فك الحمض النووي
  2. انضمام شظايا أوكازاكي
  3. إضافة النيوكليوتيدات إلى حبلا جديد
  4. تصحيح الإصلاح

السؤال 20.
التفريق بين الخصلة الرائدة من الخصلة المتأخرة
إجابة:
الساحل الرئيسي:

السؤال 21.
ما هي شظايا أوكازاكي؟
إجابة:
تسمى الأجزاء المركبة بشكل متقطع من الخيط المتأخر باسم شظايا أوكازاكي التي يتم ضمها بواسطة إنزيم DNA ligase.

السؤال 22.
ما هي شوكة النسخ المتماثل؟
إجابة:
عند نقطة أصل النسخ المتماثل ، تقوم الهليكازات والإيزوميرات العليا (DNA gyrase) بفك الخيوط وتفكيكها ، وتشكيل بنية على شكل Y تسمى شوكة النسخ المتماثل. هناك نوعان من شوكات النسخ المتماثل في كل أصل.

السؤال 23.
بصرف النظر عن بوليميريز الحمض النووي ، قم بتسمية أي أربعة إنزيمات أخرى كانت متورطة في تكرار الحمض النووي للخلية حقيقية النواة.
إجابة:
ligase DNA و Topoisomerase (DNA gyrase) و Helicase و Nuclease.

السؤال 24.
من الذي اقترح العقيدة المركزية؟ اكتب مفهومها.
إجابة:
اقترح فرانسيس كريك العقيدة المركزية في البيولوجيا الجزيئية التي تنص على أن المعلومات الجينية تتدفق على النحو التالي:

السؤال 25.
تحديد النسخ وتسمية الإنزيم المتضمن في هذه العملية.
إجابة:
تسمى عملية نسخ المعلومات الجينية من خيط واحد من الحمض النووي إلى الحمض النووي الريبي النسخ. تتم هذه العملية في وجود بوليميريز الحمض النووي الريبي المعتمد على الحمض النووي.

السؤال 26.
ما هو صندوق تاتا؟ اذكر وظيفتها.
إجابة:
في حقيقيات النوى ، يحتوي المروج على مناطق غنية تسمى TATA box أو Goldberg-Hogness box. يعمل كموقع ربط لـ RNA polymerase.

السؤال 27.
يختلف الجين البنيوي لحقيقيات النوى عن بدائيات النوى. كيف؟
إجابة:
في حقيقيات النوى ، يكون الجين الهيكلي عبارة عن ترميز أحادي لبروتين واحد فقط بينما في بدائيات النوى ، يكون الجين الهيكلي عبارة عن ترميز متعدد الكتل للعديد من البروتينات.

السؤال 28.
ما هما المكونان الرئيسيان لبوليميراز الحمض النووي الريبي بدائية النواة؟ كيف يتصرفون؟
إجابة:
يتكون بوليميراز الحمض النووي الريبي البكتيري (بدائية النواة) من مكونين رئيسيين ، الإنزيم الأساسي والوحدة الفرعية سيجما. الإنزيم الأساسي (β1 و و α) مسؤول عن تخليق الحمض النووي الريبي & # 8221 بينما تكون وحدة سيجما الفرعية مسؤولة عن التعرف على المحفز.

السؤال 29.
فرّق بين exons و introns.
إجابة:

  1. Exons: متواليات معبرة (تسلسل ترميز) لجين حقيقي النواة
  2. الإنترونات: المتواليات المتداخلة (التسلسلات غير المشفرة) لجين حقيقي النواة

السؤال 30.
تعريف الربط.
إجابة:
تسمى عملية إزالة الإنترونات من hnRNA بالربط.

السؤال 31.
ما هو السد والتخفيض؟
إجابة:
في تغطية النوكليوتيدات غير العادية ، تتم إضافة ميثيل جوانوزين ثلاثي الفوسفات في نهاية 5 بوصات من hnRNA ، بينما تتم إضافة بقايا الأدينيلات (200-300) (بولي أ) في نهاية 3 في المخلفات.

السؤال 32.
إذا كان الحمض النووي المزدوج الذي تقطعت به السبل يحتوي على 20٪ من السيتوزين ، فاحسب النسبة المئوية للأدينين في الحمض النووي.
إجابة:
Cytdsine = 20 ، ومن ثم Guanine = 20
وفقًا لقاعدة ChargafFs (A + T) = (G + C) = 100
نسبة الثايمين + الأدينين = 20 + 20 = 100
(T + A) = (20 + 20) = 100
(T + A) = 100- (20 + 20)
T + A = 100 & # 821140
T + A = 60
لذلك ستكون نسبة الأدينين 60/2 = 30٪.

السؤال 33.
اذكر الوظائف المزدوجة لـ AUG.
إجابة:
AUG لديه وظائف مزدوجة. إنه يعمل ككودون بادئ وأيضًا رمز للحمض الأميني ميثيونين.

السؤال 34.
كم عدد الكودونات التي تشارك في إنهاء الترجمة. سميهم.
إجابة:
ثلاثة أكواد تنهي عملية الترجمة. هم UAA و UAG و UGA.

السؤال 35.
انحلال الكودون & # 8211 تعليق.
إجابة:
يعني الكود المتدهور أن أكثر من كودون ثلاثي واحد يمكنه ترميز حمض أميني معين. على سبيل المثال ، الكودونات GUU و GUC و GUA و GUG code للفالين.

السؤال 36.
أشر إلى الفئات الاستثنائية لعالمية الكود الجيني.
إجابة:
لوحظت استثناءات من الطبيعة العالمية للشفرة الجينية في جينومات الميتوكوندريا والبلاستيدات الخضراء بدائية النواة.

السؤال 37.
ما هي الكودونات غير المنطقية؟
إجابة:
UGA و UAA و UAG هي الأكواد غير المنطقية التي تنهي الترجمة.

السؤال 38.
قم بتسمية الكودونات الثلاثية التي ترمز لها

السؤال 39.
لماذا يجب أن تخضع hnRNA لعملية الربط؟
إجابة:
نظرًا لأن hnRNA يحتوي على كل من متواليات التشفير (exons) والمتواليات غير المشفرة (introns) ، فيجب أن يخضع لعملية التضفير لإزالة الإنترونات.

السؤال 40.
اذكر دور الكودونات التالية في عملية الترجمة

السؤال 41.
أدناه هو تسلسل مرنا. اذكر تسلسل الأحماض الأمينية الذي تم تشكيله بعد ترجمته.
إجابة:
3'AUGAAAGAUGGGUAAA5 '
الميثيونين & # 8211 ليسين & # 8211 حمض الأسبارتيك & # 8211 الجلايسين

السؤال 42.
قم بتسمية الكودونات الأربعة التي ترمز إلى فالين.
إجابة:
GUU و GUC و GUA و GUG.

السؤال 43.
التسلسل الأساسي في أحد خيوط الحمض النووي هو TAGC ATGAT. اذكر التسلسل الأساسي في خيطه التكميلي.
إجابة:
الخصلة التكميلية لها ATCGTACTA.

السؤال 44.
لماذا يسمى t-RNA كجزيء محول؟
إجابة:
يعمل جزيء نقل الحمض النووي الريبي (tRNA) للخلية كوسيلة تلتقط الأحماض الأمينية المنتشرة عبر السيتوبلازم وتقرأ أيضًا رموزًا محددة لجزيئات الرنا المرسال. ومن ثم يطلق عليه جزيء محول.

السؤال 45.
ماذا تقصد بشحن الحمض الريبي النووي النقال؟ قم بتسمية الإنزيم المتضمن في هذه العملية.
إجابة:
تُعرف عملية إضافة الأحماض الأمينية إلى الحمض الريبي النووي النقال باسم aminoacylation أو الشحن ويسمى المنتج الناتج aminoacyl- tRNA (مشحون tRNA). يتم تحفيز aminoacylation بواسطة إنزيم aminoacyl & # 8211 tRNA synthetase.

السؤال 46.
ما هي UTR؟
إجابة:
يحتوي mRNA أيضًا على بعض التسلسلات الإضافية التي لم تتم ترجمتها ويشار إليها باسم المناطق غير المترجمة (UTR). توجد UTRs في نهاية 5 بوصات (قبل رمز البدء) وفي نهاية 3 بوصات (بعد رمز الإيقاف).

السؤال 47.
ما هو تسلسل S & # 8211 D؟
إجابة:
تحتوي نهاية 5 'من mRNA بدائيات النوى على تسلسل خاص يسبق كودون AUG الأولي لـ mRNA. يُطلق على موقع ربط الريبوسوم هذا تسلسل Shine & # 8211 Dalgamo أو تسلسل S-D. تتسلسل أزواج القواعد بمنطقة 16Sr RNA للوحدة الفرعية الريبوسومية الصغيرة التي تسهل البدء.

السؤال 48.
تحديد وحدة الترجمة.
إجابة:
وحدة الترجمة في mRNA هي تسلسل الحمض النووي الريبي المحاط بكودون البداية على 5 'end و stop codon على الطرف 3' ورموز polypeptide.

السؤال 49.
اذكر الدور المثبط للتتراسيكلين والستربتومايسين في الترجمة البكتيرية.
إجابة:
يمنع التتراسيكلين الارتباط بين aminoacyl tRNA و mRNA. يمنع الستربتومايسين بدء الترجمة ويسبب أخطاء في القراءة.

السؤال 50.
في أي مرحلة ، يتم تنظيم التعبير الجيني؟
إجابة:
يمكن التحكم في التعبير الجيني أو تنظيمه على مستويات النسخ أو الترجمة.

السؤال 51.
ما هو الاوبرون؟ اعط مثال.
إجابة:
تسمى مجموعة الجينات ذات الوظائف ذات الصلة بالأوبرون.
على سبيل المثال: lac operon في E.coli.

السؤال 52.
بالنظر إلى أوبرا لاك للإشريكية القولونية ، قم بتسمية منتجات الجينات التالية.

  1. أنا جين & # 8211 بروتين مثبط
  2. جين lac Z & # 8211 fS-galactosidase
  3. جين Lac Y & # 8211 Permease
  4. الجين lac & # 8211 transacetylase

السؤال 54.
قم بتسمية الكروموسوم البشري الذي يحتوي على

  1. يحتوي الكروموسوم 1 على أقصى عدد من الجينات (2968 جينًا)
  2. يحتوي الكروموسوم Y على أقل عدد من الجينات (231 جينًا)

السؤال 55.
ما هي النيوكلوتايد؟ اذكر استخداماته.
إجابة:
SNPs: تعدد أشكال النوكليوتيدات الفردي. يساعد في العثور على مواقع الكروموسومات للتسلسلات المرتبطة بالأمراض وتتبع التاريخ البشري.

السؤال 56.
اذكر أي أربعة مجالات يمكن فيها استخدام بصمة الحمض النووي.
إجابة:

  1. تحليل الطب الشرعي
  2. تحليل النسب
  3. الحفاظ على الحياة البرية
  4. الدراسات الأنثروبولوجية

السؤال 57.
تصنيف الحمض النووي على أساس جزيئات السكر.
إجابة:
هناك نوعان من الأحماض النووية يعتمدان على نوع سكر البنتوز. تسمى تلك التي تحتوي على سكر الديوكسيريبوز بالحمض النووي (DNA) وتعرف تلك التي تحتوي على سكر الريبوز باسم Ribonucleic Acid (RNA). الفرق الوحيد بين هذين السكرين هو أن هناك ذرة أكسجين أقل في الديوكسيريبوز.

السؤال 58.
كل من البيورينات والبيريميدينات هي قواعد نيتروجين ومع ذلك تختلف. كيف؟
إجابة:
كل من البيورينات والبيريميدينات هي قواعد نيتروجين. تحتوي قواعد البيورين Adenine و Guanine على حلقة نيتروجين مزدوجة # 8211 ، بينما تحتوي قواعد السيتوزين والثايمين على حلقة نيتروجين كربون واحدة.

السؤال 59.
كيف 5 "من الحمض النووي تختلف عن 3"؟
إجابة:
يشير 5 'من DNA إلى الكربون الموجود في السكر الذي ترتبط به المجموعة الوظيفية الفوسفاتية (P04V). يشير 3 'من الحمض النووي إلى الكربون الموجود في السكر الذي ترتبط به مجموعة الهيدروكسيل (OH).

السؤال 60.
حكم الدولة Chargaff ل.
إجابة:
وفقًا لإروين تشارجاف ،

  1. أزواج الأدينين مع الثايمين مع اثنين من الروابط الهيدروجينية.
  2. أزواج الجوانين مع السيتوزين مع ثلاث روابط هيدروجينية.

السؤال 61.
الحمض النووي كيميائيًا أكثر استقرارًا من RNA & # 8211 Justify.
إجابة:
في الحمض النووي ، يمكن أن يتكامل الخيطان ، إذا تم فصلهما عن طريق التسخين (إعادة التشبع) عند توفير الحالة المناسبة. مزيد من مجموعة 2 OH الموجودة في كل نوكليوتيد في RNA هي مجموعة تفاعلية تجعل الحمض النووي الريبي قابلًا للتحلل وقابل للتحلل بسهولة. من المعروف أيضًا أن الحمض النووي الريبي هو عامل تحفيزي ومتفاعل. ومن ثم ، فإن الحمض النووي أكثر استقرارًا كيميائيًا وأقل تفاعلًا كيميائيًا عند مقارنته بـ RNA. إن وجود الثايمين بدلاً من اليوراسيل في الحمض النووي يمنح ثباتًا إضافيًا للحمض النووي.

السؤال 62.
اكتب ببساطة عن الوضع شبه المحافظ لتكرار الحمض النووي.
إجابة:
اقترح واطسون وكريك الاستنساخ شبه المحافظ في عام 1953. وتستند آلية النسخ هذه على نموذج الحمض النووي. واقترحوا أن يتم فك شريطين عديد النوكليوتيدات من جزيء الحمض النووي والبدء في الانفصال عند أحد طرفيه. خلال هذه العملية ، تنكسر الروابط الهيدروجينية التساهمية. ثم تعمل الخصلة المفردة المنفصلة كقالب لتركيب خصلة جديدة. بعد ذلك ، يحمل كل حلزون مزدوج ابنة خيطًا واحدًا من عديد النوكليوتيد من الجزيء الأصلي الذي يعمل كقالب ويتم تصنيع الشريط الآخر حديثًا ومكملًا للحبلة الأم.

السؤال 63.
ارسم مخططًا مبسطًا للنيوكليوسوم وقم بتسميته.
إجابة:

السؤال 64.
ما هو البرايمر؟
إجابة:
التمهيدي هو امتداد قصير من الحمض النووي الريبي. يبدأ في تكوين حبلا جديد. ينتج التمهيدي نهاية 3’-OH على تسلسل الريبونوكليوتيدات ، والتي تضاف إليها ديوكسي ريبونوكليوتيدات لتشكيل حبلا جديد.

السؤال 65.
لا يتم نسخ كلا خيوط الحمض النووي أثناء النسخ. أعط السبب.
إجابة:
لا يتم نسخ خيوط الحمض النووي أثناء النسخ لسببين.

  1. إذا كان كلا الخيطين يعملان كقالب ، فسيتم ترميز RNA بتسلسلات مختلفة. وهذا بدوره من شأنه أن يرمز للبروتينات ذات تسلسلات الأحماض الأمينية المختلفة. سيؤدي هذا إلى جزء واحد من تشفير الحمض النووي لبروتينين مختلفين ، وبالتالي يعقد آلية نقل المعلومات الجينية.
  2. إذا تم إنتاج جزيئين من RNA في وقت واحد ، فسيتم تشكيل RNA مزدوج تقطعت بهم السبل مكمل لبعضهما البعض. هذا من شأنه أن يمنع RNA من أن يترجم إلى بروتينات.

السؤال 66.
ماذا تقصد بقالب حبلا وخيط ترميز؟
إجابة:
يعمل بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي الريبي على تحفيز البلمرة في اتجاه واحد فقط ، حيث يعمل الشريط الذي يحتوي على القطبية 3 "→ 5" كقالب ، ويسمى حبلا القالب. الشريط الآخر الذي له قطبية 5 "→ 3" له تسلسل مماثل لـ RNA (باستثناء الثايمين بدلاً من اليوراسيل) ويتم إزاحته أثناء النسخ. هذا الخيط يسمى حبلا الترميز.

السؤال 67.
قم بتسمية العوامل المسؤولة عن بدء وإنهاء النسخ في بدائيات النوى.
إجابة:

  1. عامل سيجما مسؤول عن بدء النسخ.
  2. عامل Rh هو المسؤول عن إنهاء النسخ.

السؤال 68.
قم بتسمية أنواع الحمض النووي الريبي الرئيسية من بدائيات النوى واذكر دورها.
إجابة:
في بدائيات النوى ، هناك ثلاثة أنواع رئيسية من الحمض النووي الريبي: mRNA ، و tRNA ، و rRNA. جميع الـ RNAs الثلاثة ضرورية لتكوين بروتين في الخلية. يوفر mRNA القالب ، بينما يجلب الحمض الريبي النووي النقال الأحماض الأمينية ويقرأ الشفرة الجينية ، وتلعب الرنا الريباسي دورًا هيكليًا وحفازًا
أثناء الترجمة.

السؤال 69.
تحديد الكود الجيني.
إجابة:
يتحكم ترتيب أزواج القواعد على طول جزيء الحمض النووي في نوع وترتيب الأحماض الأمينية الموجودة في بروتينات الكائن الحي. يسمى هذا الترتيب المحدد للأزواج الأساسية بالشفرة الجينية.

السؤال 70.
اشرح فرضية التذبذب.
إجابة:
تم اقتراح فرضية Wobble بواسطة Crick (1966) والتي تنص على أن tRNA anticodon لديه القدرة على التذبذب عند نهايته 5 عن طريق الاقتران مع قاعدة غير مكملة من كودون mRNA. & # 8217 وفقًا لهذه الفرضية ، في الاقتران بين الكودون والمضاد للكودون قد لا تكون القاعدة الثالثة مكملة.

القاعدة الثالثة من الكودون تسمى القاعدة المتذبذبة وهذا الموضع يسمى الوضع المتذبذب. يحدث الاقتران الأساسي الفعلي في أول موضعين فقط. تكمن أهمية فرضية التذبذب في أنها تقلل من عدد الحمض النووي الريبي (tRNAs) المطلوب لتخليق عديد الببتيد وتتغلب على تأثير انحطاط الكود.

السؤال 71.
اشرح طبيعة الريبوسوم حقيقيات النوى.
إجابة:
ريبوسومات حقيقيات النوى (80 ثانية) أكبر ، وتتكون من 60 وحدة فرعية و 40 ثانية. يشير الحرف "S" إلى كفاءة الترسيب التي يتم التعبير عنها بوحدة Svedberg (S). تتكون الوحدة الفرعية الأكبر في حقيقيات النوى من جزيء 23 S RNA و 5Sr RNA و 31 بروتينًا ريبوسوميًا. تتكون الوحدة الفرعية حقيقية النواة الأصغر من مكون 18Sr RNA وحوالي 33 بروتينًا.

السؤال 72.
قم بتوسيع وتعريف ORF.
إجابة:
يُعرف أي تسلسل من الحمض النووي أو الحمض النووي الريبي ، بدءًا من كودون البداية والذي يمكن ترجمته إلى بروتين باسم إطار القراءة المفتوح (ORF).

السؤال 73.
ما هي مكونات مجمع بدء الترجمة بدائية النواة؟
إجابة:
يبدأ بدء الترجمة في الإشريكية القولونية بتكوين معقد بدء ، يتكون من وحدات فرعية 30S من الريبوسوم ، ورسول RNA و N-formyl methionine tRNA المشحون (f met -1 RNA f met) ، ثلاثة عوامل بدء بروتينية (IF 1، IF2، IF3)، GTP (Guaniner Tri Phosphate) و Mg 2+.

السؤال 74.
اشرح مكونات الاوبرون.
إجابة:
هيكل الأوبرا: كل أوبرون هو وحدة للتعبير الجيني والتنظيم ويتكون
لواحد أو أكثر من الجينات الهيكلية وجين عامل مجاور يتحكم في النسخ
نشاط الجين الهيكلي.

  1. أكواد الجينات الهيكلية للبروتينات ، الرنا الريباسي و الحمض الريبي النووي النقال التي تتطلبها الخلية.
  2. المروجين هي تسلسلات الإشارات في الحمض النووي التي تبدأ تخليق الحمض النووي الريبي. يرتبط RNA polymerase I بالمروج قبل بدء النسخ.
  3. المشغلون موجودون بين المروجين والجينات الهيكلية. يرتبط بروتين المثبط بمنطقة المشغل في المشغل.

السؤال 75.
وصف تجربة هيرشي وتشيس. ما الذي خلصت إليه تجربتهم؟
إجابة:
أجرى ألفريد هيرشي ومارثا تشيس (1952) تجارب على العاثيات التي تصيب البكتيريا. Phage T2 هو فيروس يصيب بكتيريا الإشريكية القولونية.عندما تضاف العاثيات (الفيروس) إلى البكتيريا ، فإنها تمتص إلى السطح الخارجي ، وتدخل بعض المواد إلى البكتيريا ، ثم بعد ذلك كل خلية بكتيرية لإطلاق عدد كبير من العاثيات النسل. أراد هيرشي وتشيس مراقبة ما إذا كان الحمض النووي أو البروتين هو الذي دخل البكتيريا. تحتوي جميع الأحماض النووية على الفوسفور ، وتحتوي على الكبريت (في الأحماض الأمينية السيستين والميثيونين). صمم هيرشي وتشيس تجربة باستخدام النظائر المشعة للكبريت (35 س) والفوسفور (32 ف) للحفاظ على مسار منفصل للبروتين الفيروسي والأحماض النووية أثناء عملية العدوى.

تم السماح للعاثيات بإصابة البكتيريا في وسط المزرعة الذي يحتوي على النظائر المشعة 35 S أو 32 P. كانت العاثية التي نمت في وجود 35 S تحتوي على بروتينات وعاثيات نمت في وجود 32 P تحمل علامة DNA. وهكذا مكنهم التوصيف التفاضلي من التعرف على الحمض النووي والبروتينات الخاصة بالعاثية. قام هيرشي وتشيس بخلط العاثيات المسمى مع الإشريكية القولونية غير المسماة وسمح للعاثيات بمهاجمة وحقن مادتها الجينية. بعد فترة وجيزة من الإصابة (قبل تحلل البكتيريا) ، تم تحريك الخلايا البكتيرية برفق في الخلاط لتخفيف جزيئات المرحلة الملتصقة.

لوحظ أنه تم العثور على 32 P فقط مرتبطة بالخلايا البكتيرية و 35 S كانت في الوسط المحيط وليس في الخلايا البكتيرية. عندما تم دراسة سلالة الملتهمة من أجل النشاط الإشعاعي ، وجد أنها تحمل 32 P فقط وليس 35 S. تشير هذه النتائج بوضوح إلى أن الحمض النووي فقط وليس غلاف البروتين دخل الخلايا البكتيرية. وهكذا أثبت هيرشي وتشيس بشكل قاطع أن الحمض النووي ، وليس البروتين ، هو الذي يحمل المعلومات الوراثية من الفيروس إلى البكتيريا.

السؤال 76.
اشرح خصائص الحمض النووي التي تجعله مادة وراثية مثالية.
إجابة:
1. النسخ المتماثل الذاتي: يجب أن يكون قادرًا على التكرار. وفقًا لقاعدة الاقتران والتكامل الأساسيين ، فإن كلا من الأحماض النووية (DNA و RNA) لديها القدرة على توجيه الازدواجية. البروتينات تفشل في تلبية هذه المعايير.

2. الاستقرار: يجب أن يكون مستقرا هيكليا وكيميائيا. يجب أن تكون المادة الجينية مستقرة بدرجة كافية حتى لا تتغير مع المراحل المختلفة لدورة الحياة أو العمر أو مع تغير في فسيولوجيا الكائن الحي. كان الاستقرار كأحد خصائص المادة الجينية واضحًا في مبدأ تحويل جريفيث. الحرارة التي تقتل البكتيريا لا تدمر بعض خواص المادة الوراثية. في الحمض النووي ، يكون الخيطان متكاملين.

إذا تم فصل (تشويه) عن طريق التسخين يمكن أن يجتمع (إعادة التشبع) عندما يتم توفير الحالة المناسبة. مزيد من مجموعة 2 'OH الموجودة في كل نوكليوتيد في RNA هي مجموعة تفاعلية تجعل الحمض النووي الريبي قابلًا للتحلل وقابل للتحلل بسهولة. من المعروف أيضًا أن الحمض النووي الريبي هو عامل تحفيزي ومتفاعل. ومن ثم ، فإن الحمض النووي أكثر استقرارًا كيميائيًا وأقل تفاعلًا كيميائيًا عند مقارنته بـ RNA. إن وجود الثايمين بدلاً من اليوراسيل في الحمض النووي يمنح ثباتًا إضافيًا للحمض النووي.

3. تخزين المعلومات: يجب أن تكون قادرة على التعبير عن نفسها في شكل "الشخصيات المندلية". يمكن للحمض النووي الريبي أن يرمز مباشرة لتخليق البروتين ويمكن أن يعبر بسهولة عن الشخصيات. ومع ذلك ، يعتمد الحمض النووي على الحمض النووي الريبي لتخليق البروتينات. يمكن أن يعمل كل من الحمض النووي والحمض النووي الريبي كمواد وراثية ، لكن كون الحمض النووي أكثر استقرارًا يخزن المعلومات الجينية وينقل الحمض النووي الريبي المعلومات الجينية.

4. الاختلاف من خلال الطفرة: يجب أن يكون قادرًا على التحور. كل من DNA و RNA قادران على التحور. كون الحمض النووي الريبي غير مستقر ، فإنه يتحور بمعدل أسرع. وبالتالي ، يمكن للفيروسات التي تحتوي على جينوم الحمض النووي الريبي مع عمر أقصر أن تتحور وتتطور بشكل أسرع. تشير المناقشة أعلاه إلى أن كلا من الحمض النووي الريبي والحمض النووي يمكن أن يعمل كمواد وراثية. الحمض النووي أكثر استقرارًا ، ويفضل تخزين المعلومات الجينية.

السؤال 77.
كيف يتم تعبئة الحمض النووي في خلية حقيقية النواة؟ قدم
إجابة:
في حقيقيات النوى ، التنظيم أكثر تعقيدًا. يتكون الكروماتين من سلسلة من الوحدات المتكررة تسمى النيوكليوسومات. اقترح Komberg نموذجًا للنيوكليوسوم ، حيث يتم تنظيم جزيئين من بروتينات الهيستون الأربعة H2A و H2B و H3 و H4 لتشكيل وحدة من ثمانية جزيئات تسمى هيستون أوكتامير. يتم لف الحمض النووي المشحون سالبًا حول أوكتامير هيستون موجب الشحنة لتشكيل بنية تسمى nucleosome. يحتوي النوكليوسوم النموذجي على 200 نقطة أساس من حلزون الحمض النووي. تكون أوكتاميرات الهيستون على اتصال وثيق ويتم لف الحمض النووي على السطح الخارجي للنيوكليوسوم. ترتبط النيوكليوسومات المجاورة بواسطة رابط DNA (HI) الذي يتعرض للإنزيمات.

يقوم الحمض النووي بدورتين كاملتين حول أوكتاميرات هيستون ويتم إغلاق المنعطفين بواسطة جزيء HI. يتميز الكروماتين الذي يفتقر إلى HI بمظهر خرز على سلسلة يتداخل فيه الحمض النووي ويترك النوكليوزومات في أماكن عشوائية. يمكن أن يتفاعل HI لنيوكليوسوم واحد مع 33 لترًا من النيوكليوسومات المجاورة مما يؤدي إلى مزيد من طي الألياف.

ألياف chrof & ampatin في نوى الطور البيني والكروموسومات الانقسامية لها قطر يتراوح بين 200-300 نانومتر ويمثل الكروماتين غير النشط. تنشأ ألياف 30 نانومتر من طي nucfeosbme ، وهي سلاسل في هيكل ملف لولبي به ستة نيوكليوسومات في كل دور. يتم تثبيت هذا الهيكل عن طريق التفاعل بين جزيئات HI المختلفة. الحمض النووي هو ملف لولبي ومعبأ بحوالي ،٪) _ طيات. تم توضيح الطبيعة الهرمية لبنية الكروموسوم.

هناك حاجة إلى مجموعة إضافية من pteins لتعبئة الكروماتين على مستوى أعلى ويشار إليها باسم بروتينات كروموسومية غير هيستون (NHC). في * ، نواة نموذجية ، تكون بعض مناطق الكروماتين معبأة بشكل إيبوسيلي (ملطخة قليلاً) ويشار إليها بالكروماتين الحقيقي. يسمى الكروماتين المعبأ بإحكام (ملطخ بشكل غامق) بالكروماتين المتغاير. الكروماتين الأصلي نشط نسبيًا ، بينما الكروماتين المتغاير غير نشط نسبيًا.

السؤال 78.
أثبتت تجربة Meselson و Stahl وضع شبه coflBptervation لتكرار الحمض النووي. يشرح.
إجابة:
تم تحديد طريقة تكرار الحمض النووي في عام 1958 بواسطة Meselson و Stahl. لقد صمموا تجربة للتمييز بين المضاعفات شبه المحافظة والمحافظة والمشتتة. في تجربتهم ، قاموا بتنمية ثقافتين من الإشريكية القولونية لعدة أجيال في وسائط منفصلة. تمت زراعة المزرعة "الثقيلة" في وسط احتوى فيه مصدر النيتروجين (NH4CI) على النظير الثقيل 15 N وزُرعت الثقافة "الخفيفة" في وسط يحتوي فيه مصدر النيتروجين على نظير خفيف 14 H لعدة أجيال. في نهاية النمو ، لاحظوا أن الحمض النووي البكتيري في المزرعة الثقيلة يحتوي على 15 نيوتن فقط وفي المزرعة الخفيفة فقط 14 نيوتن يمكن تمييز الحمض النووي الثقيل عن الحمض النووي الخفيف (15 نيوتن من 14 نيوتن) باستخدام تقنية تسمى السيزيوم كلوريد (CsCl) الطرد المركزي المتدرج الكثافة. في هذه العملية ، استقر الحمض النووي الثقيل والخفيف المستخرج من الخلايا في ثقافتين مختلفتين في شريطين متميزين ومنفصلين (الحمض النووي الهجين).

تم بعد ذلك نقل الثقافة الثقيلة (15 نيوتن) إلى وسط يحتوي على NH4CI فقط ، وأخذ عينات على فترات زمنية محددة مختلفة (مدة 20 دقيقة). بعد النسخ المتماثل الأول ، استخرجوا الحمض النووي وأخضعوه للطرد المركزي المتدرج الكثافة. استقر الحمض النووي في شريط كان وسيطًا في الموضع بين العصابات الثقيلة والخفيفة المحددة مسبقًا. بعد التكرار الثاني (مدة 40 دقيقة) ، استخرجوا عينات الحمض النووي مرة أخرى ، ووجدوا هذه المرة أن الحمض النووي يستقر في شريطين ، أحدهما في موضع النطاق الخفيف والآخر في موضع متوسط. تؤكد هذه النتائج فرضية Watson and Crick شبه المحافظة في التكرار.

السؤال 79.
قدم وصفًا تفصيليًا لوحدة النسخ.
إجابة:
يتم تحديد وحدة النسخ في الحمض النووي من خلال ثلاث مناطق ، المحفز ، والجين الهيكلي والمُنهي. يقع المروج نحو نهاية 5. إنه تسلسل DNA يوفر موقع ربط لـ RNA polymerase. إن وجود المروج في وحدة النسخ يحدد القالب وخيوط الترميز. تحتوي المنطقة النهائية الواقعة في الطرف الثالث من خيط الترميز على تسلسل DNA الذي يتسبب في توقف بوليميراز الحمض النووي الريبي عن النسخ. في حقيقيات النوى ، يمتلك المروج مناطق غنية تسمى TATA box (Goldberg- Hogness box) & # 8216 وفي بدائيات النوى تسمى هذه المنطقة صندوق Pribnow.

إلى جانب المروج ، تتطلب حقيقيات النوى أيضًا معززًا. إن شريطين من الحمض النووي في الجين الهيكلي لوحدة النسخ لهما قطبية معاكسة. يحفز بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي البلمرة في اتجاه واحد فقط ، حيث يعمل الشريط الذي يحتوي على القطبية 3 "→ 5" كقالب ، ويسمى حبلا القالب. الشريط الآخر الذي له قطبية 5 "→ 3" له تسلسل مماثل لـ RNA (باستثناء الثايمين بدلاً من اليوراسيل) ويتم إزاحته أثناء النسخ. هذا الخيط يسمى حبلا الترميز

قد يكون الجين الهيكلي أحادي النواة (حقيقيات النوى) أو متعدد النواة (بدائيات النوى). في حقيقيات النوى ، يحمل كل mRNA جينًا واحدًا فقط ويرمز المعلومات لبروتين واحد فقط ويسمى monocistronic mRNA. في بدائيات النوى ، يتم نسخ مجموعات من الجينات ذات الصلة ، والمعروفة باسم الأوبرا ، والتي غالبًا ما توجد بجانب بعضها البعض على الكروموسوم معًا لإعطاء مرنا واحد ، وبالتالي فهي متعددة الخلايا.

السؤال 80.
اشرح عملية النسخ في بدائيات النوى مع الرسم التخطيطي المطلوب.
إجابة:
في بدائيات النوى ، هناك ثلاثة أنواع رئيسية من الحمض النووي الريبي:
mRNA و tRNA و rRNA. جميع الـ RNAs الثلاثة ضرورية لتخليق البروتين في الخلية. يوفر mRNA القالب ، بينما يجلب الحمض النووي الريبي الأحماض الأمينية ويقرأ الشفرة الجينية ، وتلعب الرنا الريباسي دورًا هيكليًا وحفازًا أثناء الترجمة. يوجد بوليميراز RNA واحد يعتمد على الحمض النووي والذي يحفز نسخ جميع أنواع الحمض النووي الريبي. يرتبط بالمروج ويبدأ النسخ (البدء).

تسمى مواقع الربط بالبوليميراز المحفزات. يستخدم نيوكليوزيد ثلاثي الفوسفات كركيزة وبوليميراز في قالب يعتمد على الموضة وفقًا لقاعدة التكامل. بعد بدء النسخ ، يستمر البوليميراز في إطالة الحمض النووي الريبي ، مضيفًا نوكليوتيدًا تلو الآخر إلى سلسلة الحمض النووي الريبي المتنامية. يبقى فقط امتداد قصير من الحمض النووي الريبي مرتبطًا بالإنزيم ، عندما يصل البوليميراز إلى نقطة نهاية في نهاية الجين ، يسقط الحمض النووي الريبي الوليد ، وكذلك أيضًا بوليميريز الحمض النووي الريبي. إن بوليميراز RNA قادر فقط على تحفيز عملية الاستطالة. يرتبط بوليميراز الحمض النووي الريبي بشكل عابر بعامل البدء سيجما (أ) وعامل الإنهاء rho (ع) لبدء النسخ وإنهائه ، على التوالي.

يوجه ارتباط الحمض النووي الريبي مع هذه العوامل بوليميريز الحمض النووي الريبي إما لبدء أو إنهاء عملية النسخ. في البكتيريا ، نظرًا لأن mRNA لا يتطلب أي معالجة لتصبح نشطة وأيضًا نظرًا لأن النسخ والترجمة يحدثان في وقت واحد في نفس الحجرة نظرًا لعدم وجود فصل بين العصارة الخلوية والنواة في البكتيريا) ، يمكن أن تبدأ الترجمة في كثير من الأحيان قبل أن يكون mRNA مكتوبة بالكامل. وذلك لأن المادة الوراثية لا يتم فصلها عن عضيات الخلية الأخرى بواسطة غشاء نووي وبالتالي يمكن أن يقترن النسخ والترجمة في البكتيريا.

السؤال 81.
اكتب السمات البارزة للشفرة الجينية.
إجابة:
السمات البارزة للشفرة الجينية هي كما يلي:

  1. الكودون الجيني هو رمز ثلاثي و 61 كودون للأحماض الأمينية و 3 كودونات لا ترمز لأي حمض أميني وتعمل ككودون توقف (إنهاء).
  2. الكود الجيني عالمي. وهذا يعني أن جميع الأنظمة الحية المعروفة تستخدم الأحماض النووية وأن نفس الكودونات الأساسية الثلاثة (الكودون الثلاثي) توجه تخليق البروتين من الأحماض الأمينية. على سبيل المثال ، رموز كودون mRNA (UUU) للفينيل ألانين في جميع خلايا جميع الكائنات الحية. تم الإبلاغ عن بعض الاستثناءات في جينومات بدائية النواة والميتوكوندريا والبلاستيدات الخضراء. ومع ذلك ، فإن أوجه التشابه أكثر شيوعًا من الاختلافات.
  3. يعني الرمز غير المتداخل أن نفس الحرف لا يستخدم لكودونين مختلفين. على سبيل المثال ، يمثل تسلسل النوكليوتيدات GUTJ و GUC كودونين فقط.
  4. إنها أقل بفاصلة ، مما يعني أنه سيتم قراءة الرسالة مباشرة من طرف إلى آخر ، أي لا حاجة إلى علامات ترقيم بين رمزين.
  5. يعني الكود المتدهور أن أكثر من كودون ثلاثي واحد يمكنه ترميز حمض أميني معين. على سبيل المثال ، الكودونات GUU و GUC و GUA و GUG code للفالين.
  6. رمز غير غامض يعني أن كودون واحد سيرمز لحمض أميني واحد.
  7. تتم قراءة الكود دائمًا في اتجاه ثابت ، أي من اتجاه 5 "→ 3" يسمى القطبية.
  8. AUG لديه وظائف مزدوجة. إنه يعمل ككودون بادئ وأيضًا رمز للحمض الأميني ميثيونين.
  9. يتم تعيين أكواد UAA و UAG (التيروزين) و UGA (التربتوفان) على أنها كودونات إنهاء (إيقاف) وتُعرف أيضًا باسم الكودونات "غير المنطقية".

السؤال 82.
تؤثر الطفرات في الكود الجيني على النمط الظاهري. وصف مع المثال.
إجابة:
أبسط نوع من الطفرات على المستوى الجزيئي هو التغيير في النوكليوتيدات الذي يستبدل قاعدة بأخرى. تُعرف هذه التغييرات بالبدائل الأساسية التي قد تحدث تلقائيًا أو بسبب تأثير المطفرات. من الأمثلة المدروسة جيدًا فقر الدم المنجلي في البشر والذي ينتج عن طفرة نقطية في أليل جين هيموجلوبين بيتا (βHb).

يتكون جزيء الهيموغلوبين من أربع سلاسل متعددة الببتيد من نوعين ، اثنتان من سلاسل وسلسلتان من النوع P. كل سلسلة لها مجموعة هيم على سطحها. تشارك مجموعات الهيم في ربط الأكسجين. مرض الدم الجرمان ، فقر الدم المنجلي ناتج عن الهيموجلوبين غير الطبيعي. يرجع هذا الشذوذ في الهيموجلوبين إلى استبدال قاعدة واحدة في الكودون السادس من جلوبينجين بيتا من GAG إلى GTG في سلسلة p من الهيموغلوبين.

ينتج عنه تغيير حمض الغلوفينيك من الأحماض الأمينية إلى حمض أميني فالين في الموضع السادس من سلسلة p. هذا هو المثال الكلاسيكي للطفرة النقطية التي تؤدي إلى تغيير الأحماض الأمينية المتبقية من حمض الجلوتاميك إلى حمض الفالين. يخضع الهيموغلوبين الطافر لعملية البلمرة تحت ضغط الأكسجين مما يتسبب في تغيير شكل كرات الدم الحمراء من كهف ثنائي إلى هيكل على شكل منجل.

السؤال 83.
اشرح آلية AteArperon من E-coli.
إجابة:
أوبر لاك (اللاكتوز): يتطلب استقلاب اللاكتوز في الإشريكية القولونية ثلاثة إنزيمات & # 8211 permease ، P-galactosidase (P-gat) و transacetylase. إن نفاذ الإنزيم ضروري لدخول اللاكتوز إلى الخلية ، ويؤدي Pjgglactosidase إلى التحلل المائي للاكتوز إلى الجلوكوز والجالاكتوز ، في حين أن مجموعة الأسيتيل العابرة لنقل اللاكتوز من الأسيتيل Co A إلى P-galactosidase. يتكون مشغل lac من جين منظم واحد (يشير الجين T إلى المانع) مواقع المروج (p) ، وموقع المشغل (o). إلى جانب ذلك ، يحتوي على ثلاثة جينات هيكلية وهي lac z و y و lac a. أكواد الجينات lac ‘z’ لـ P-gaiaqtttsidase ، أكواد الجينات lac ‘y’ للتراخيص و ‘أكواد’ الجينات لـ transacetylase.

اقترح جاكوب ومونود النموذج الكلاسيكي لأوبيرون لاك لشرح التعبير الجيني والتنظيم في الإشريكية القولونية. في أمريكا اللاتينية والكاريبي ، يتم تنظيم الجين الهيكلي متعدد الكريات بواسطة محفز مشترك وجينفك تنظيمي عندما تستخدم الخلية مصدر طاقتها الطبيعي مثل الجلوكوز ، يقوم الجين "i" بنسخ مثبط mRNA وبعد ترجمته ، يتم إنتاج بروتين مثبط. يرتبط بمنطقة المشغل في المشغل ويمنع الترجمة ، ونتيجة لذلك ، لا يتم إنتاج P-galactosidase. في حالة عدم وجود مصدر كربون مفضل مثل الجلوكوز ، إذا كان اللاكتوز متاحًا كمصدر للطاقة للبكتيريا ، فإن اللاكتوز يدخل الخلية نتيجة إنزيم بيرميز. يعمل اللاكتوز كمحفز ويتفاعل مع القامع لتعطيله.

يرتبط بروتين المثبط بمشغل المشغل ويمنع بوليميريز الحمض النووي الريبي من نسخ الأوبون. في وجود محفز ، مثل اللاكتوز أو الأولااكتوز ، يتم تعطيل المثبط بالتفاعل مع المحرض. يسمح هذا لـ RNA polymerase بالارتباط بموقع المروج ونسخ المشغل لإنتاج lac mRNA الذي يتيح تكوين جميع الإنزيمات المطلوبة لاستقلاب اللاكتوز. هذا التنظيم من lac operon من قبل المكبِط هو مثال على التحكم السلبي في بدء النسخ.

السؤال 84.
ما هي أهداف مشروع الجينوم البشري؟
إجابة:
الأهداف الرئيسية لمشروع الجينوم البشري هي كما يلي:

  1. حدد جميع الجينات (حوالي 30000) في الحمض النووي البشري.
  2. حدد تسلسل الثلاثة مليارات زوج من القواعد الكيميائية التي تشكل الحمض النووي البشري.
  3. لتخزين هذه المعلومات في قواعد البيانات.
  4. تحسين أدوات تحليل البيانات.
  5. نقل التقنيات ذات الصلة إلى قطاعات أخرى ، مثل الصناعات.
  6. معالجة القضايا الأخلاقية والقانونية والاجتماعية (ELSI) التي قد تنشأ عن المشروع.

السؤال 85.
اكتب السمات البارزة لمشروع الجينوم البشري.
إجابة:

  1. على الرغم من أن الجينوم البشري يحتوي على 3 مليارات قاعدة نيوكليوتيد ، فإن تسلسل الحمض النووي الذي يشفر البروتينات لا يشكل سوى حوالي 5٪ من الجينوم.
  2. يتكون الجين المتوسط ​​من 3000 قاعدة ، أكبر جين بشري معروف هو ديستروفين مع 2.4 مليون قاعدة.
  3. وظيفة 50٪ من الجينوم مشتق من عناصر قابلة للنقل مثل تسلسل LINE و ALU.
  4. تتوزع الجينات على 24 كروموسوم. يحتوي الكروموسوم 19 على أعلى كثافة جينية. كروموسوم 13 وكروموسوم Y لهما أدنى كثافة جينية.
  5. يُظهر التنظيم الكروموسومي للجينات البشرية تنوعًا.
  6. قد يكون هناك 35000-40000 جين في الجينوم وما يقرب من 99.9 قاعدة نيوكليوتيد متماثلة تمامًا في جميع الأشخاص.
  7. وظائف أكثر من 50 بالمائة من الجينات المكتشفة غير معروفة.
  8. أقل من 2 في المائة من رموز الجينوم للبروتينات.
  9. تشكل التسلسلات المتكررة جزءًا كبيرًا جدًا من الجينوم البشري. لا تحتوي التسلسلات المتكررة على وظائف ترميز مباشرة ولكنها تسلط الضوء على بنية الكروموسوم وديناميكياته وتطوره (التنوع الجيني).
  10. يحتوي الكروموسوم 1 على 2968 جينًا ، بينما يحتوي الكروموسوم "Y" على 231 جينًا.
  11. حدد العلماء حوالي 1.4 مليون موقع ، حيث تحدث الاختلافات في الحمض النووي الفردي (SNPs & # 8211 Single nucleotidepolymorphism # 8211 على أنها "قصاصات") تحدث في البشر. يعد تحديد "SNIPS" مفيدًا في العثور على مواقع الكروموسومات للتسلسلات المرتبطة بالأمراض وتتبع التاريخ البشري.

السؤال 86.
وصف المبدأ المتضمن في تقنية بصمة الحمض النووي.
إجابة:
تم تطوير تقنية بصمة الحمض النووي لأول مرة بواسطة أليك جيفريز في عام 1985. الحمض النووي للشخص وبصمات الأصابع فريدة من نوعها. يوجد 23 زوجًا من الكروموسومات البشرية مع 1.5 مليون زوج من الجينات. من الحقائق المعروفة جيدًا أن الجينات عبارة عن أجزاء من الحمض النووي تختلف في تسلسل النيوكليوتيدات الخاصة بها. ليست كل أجزاء كود الدنا للبروتينات ، فبعض أجزاء الدنا لها وظيفة تنظيمية ، بينما البعض الآخر يتدخل في التسلسلات (الإنترونات) والبعض الآخر عبارة عن تسلسلات متكررة للحمض النووي. في بصمة الحمض النووي ، تكون تسلسلات النوكليوتيدات القصيرة المتكررة خاصة بالفرد. تسمى متواليات النيوكليوتيدات هذه على أنها تكرارات ترادفية متغيرة العدد (VNTR). تظهر VNTRs لشخصين بشكل عام اختلافات وهي مفيدة كعلامات جينية.

تتضمن طباعة أصابع الحمض النووي تحديد الاختلافات في بعض المناطق المحددة في تسلسل الحمض النووي يسمى الحمض النووي المتكرر ، لأنه في هذه التسلسلات ، يتم تكرار امتداد صغير من الحمض النووي عدة مرات. يتم فصل هذه الحمض النووي المتكرر عن الحمض النووي الجيني السائب على شكل قمم مختلفة أثناء الطرد المركزي المتدرج الكثافة. يشكل الحمض النووي السائب ذروة كبيرة ويشار إلى القمم الصغيرة الأخرى باسم DNA الساتلي. اعتمادًا على التركيب الأساسي (A: T rich أو G: C rich) ، طول المقطع وعدد الوحدات المتكررة ، يتم تصنيف DNA الساتلي إلى العديد من الفئات الفرعية & # 8211 مثل الأقمار الصناعية الصغيرة والأقمار الصناعية الصغيرة ، إلخ.

لا ترمز هذه التسلسلات لأي بروتينات ، لكنها تشكل جزءًا كبيرًا من الجينوم البشري. تظهر هذه التسلسلات درجة عالية من تعدد الأشكال وتشكل أساس بصمة الحمض النووي. يمكن مقارنة الحمض النووي المعزول من الدم أو الشعر أو خلايا الجلد أو الأدلة الجينية الأخرى المتروكة في مسرح الجريمة من خلال أنماط VNTR ، مع الحمض النووي لمشتبه به جنائي لتحديد الذنب أو البراءة. تعد أنماط VNTR مفيدة أيضًا في تحديد هوية ضحية القتل ، إما من الحمض النووي الموجود كدليل أو من الجسم نفسه.

السؤال 87.
ارسم مخطط انسيابي يوضح خطوات تقنية بصمات أصابع الحمض النووي
إجابة:

أسئلة مهارات التفكير العليا

السؤال رقم 1.
يحتوي خيط الرنا المرسال على سلسلة من الكودونات الثلاثية التي ترد منها الكودونات الثلاثة الأولى أدناه
(أ) أغسطس
(ب) UUU
(ج) المحتوى الذي ينشئه المستخدمون
(ط) قم بتسمية الحمض الأميني المشفر بواسطة هذه الكودونات الثلاثية.
(2) أذكر تسلسل الحمض النووي الذي كان من الممكن أن يتم نسخ هذه الكودونات الثلاثية منه؟
إجابة:
(ط) رموز AUG للميثيونين
رموز UUU للفينيل ألانين
رموز UGC لسيستين
(2) يتم نسخ تسلسل TAC للحمض النووي إلى AUG
يتم نسخ تسلسل AAA من الحمض النووي إلى UUU
يتم نسخ تسلسل ACG للحمض النووي إلى UGC

السؤال 2.
فيما يلي تراكيب جزيئات الحمض الريبي النووي النقال التي تشارك في عملية الترجمة. في أحد الحمض النووي الريبي ، تم ذكر الكودون ولكن ليس الحمض الأميني. في جزيء tRNA آخر ، يتم تسمية الحمض الأميني وليس الكودون. أكمل الشكل بذكر الأحماض الأمينية والكودونات المعنية.
إجابة:

السؤال 3.
يحتوي جزء من الحمض النووي على 32 قاعدة أدينين و 32 قاعدة سيتوزين. كم إجمالي عدد النيوكليوتيدات التي يحتوي عليها جزء الحمض النووي؟ يشرح.
إجابة:
128 نيوكليوتيدات. الأدينين دائمًا يقرن قاعدة الثايمين. إذا كان هناك 32 قاعدة من الأدينين ، فيجب أن يكون هناك 32 قاعدة ثايمين. أزواج السيتوزين بالمثل مع الجوانين. إذا كانت قواعد السيتوزين هي 32 في العدد ، فإن قواعد الجوانين ستكون مساوية للسيتوزين. لذلك يتكون ما مجموعه 128 نيوكليوتيد.

السؤال 4.
فيما يلي تسلسل DNA يمثل جزءًا من الجين TAC TCG CCC TAT UAA CCC AAA ACC TCT باستخدام هذا المشتق A.


الباحث عن ORF:

برنامج البحث عن ORF هو برنامج متاح على موقع NCBI. يحدد جميع إطارات القراءة المفتوحة أو منطقة ترميز البروتين المحتملة في التسلسل. يُظهر 6 أشرطة أفقية تقابل أحد إطارات القراءة الممكنة. في كل اتجاه من اتجاه الحمض النووي ، سيكون هناك 3 إطارات قراءة محتملة. لذلك سيكون إجمالي 6 إطارات قراءة محتملة (6 أشرطة أفقية) موجودًا لكل تسلسل DNA. إطارات القراءة الستة المحتملة هي +1 و +2 و +3 و -1 و -2 و -3 في الشريط العكسي. يمكن حفظ الأحماض الأمينية الناتجة والبحث في قواعد بيانات البروتين المختلفة باستخدام الانفجار للعثور على تسلسلات مماثلة أو أحماض أمينية. تعرض النتيجة تسلسل البروتين المحتمل وطول إطار القراءة المفتوح وما إلى ذلك.


اكتشاف رئيسي حول كيفية تشغيل الجينات وإيقاف تشغيلها - & # 8220 الآثار الحرجة على صحة الإنسان & # 8221

تمتلك أجسام البشر ما يقرب من 30000 جين لا تملي فقط كيف ننظر ، ولكن أيضًا العمليات البيولوجية الحرجة. الآن ، اكتشف فريق بحثي من جامعة ولاية فلوريدا وجامعة أستراليا الوطنية جانبًا رئيسيًا من جوانب تنظيم الجينات ، وفي النهاية كيف تتورط هذه العملية في الإصابة بالسرطان.

قام جوناثان دينيس ، الأستاذ المساعد في العلوم البيولوجية بجامعة ولاية فلوريدا ، وديفيد تريميثيك ، الأستاذ في جامعة أستراليا الوطنية ، بنشر بحث جديد في اتصالات الطبيعة يكشف عن معلومات أساسية حول منطقة التحكم في الجين - حيث ترتبط البروتينات لتشغيل الجينات أو إيقاف تشغيلها. وجد الباحثون أن الطريقة التي يتم بها تجميع هذه المنطقة تملي كيفية التعبير عن الجينات أو تقييدها.

تشير العبوة إلى جميع خصائص كيفية ومكان ارتباط هذه البروتينات. وأشار دينيس إلى أن هذه العملية بالغة الأهمية لبيولوجيا الإنسان.

قال: "عندما يرتبط الشيء الخطأ ، تحصل على فسيولوجيا غير مناسبة ، وفي بعض الحالات ، السرطان".

تتحدى المعلومات الجديدة النماذج الحالية لكيفية التعبير عن الجين من خلال الكشف عن وجود العديد من الطرق المختلفة التي يمكن بها تعبئة المحفز للسماح بالتعبير عن الجين أو تقييده.

يلعب بروتين يسمى H2A.Z دورًا مهمًا في تنظيم هذه التعبئة من الجينات بطرق مختلفة. وجد الباحثون أن أحد الأدوار المهمة لـ H2A.Z في تنظيم الجينات هو التأكد من أن العوامل التنظيمية المناسبة فقط هي التي يمكنها الوصول إلى محفزات الجينات.

"H2A.Z هو نوع من البروتين يسمى متغير هيستون" ، هذا ما قالته لورين كول ، طالبة دكتوراة سابقة في الجامعة الأمريكية ، والمؤلفة الأولى في الورقة. "نظرًا لأن متغيرات هيستون تلعب دورًا مهمًا في تنظيم الجينات ، فإن هذا العمل يؤدي إلى فهم موسع للجينوم البشري."

قال Tremethick إن النتيجة تؤكد مقدار العمل المتبقي لفهم الجينوم البشري وكيف يمكن لهذا الاكتشاف أن يدفع المجال إلى الأمام.

قال تريميثيك: "على الرغم من مرور ما يقرب من 20 عامًا على تسلسل الجينوم البشري ، فإن كيفية استخدام هذه المعلومات الجينومية بشكل انتقائي لتوجيه أنماط التعبير الجيني التي تدعم قرارات مصير الخلية لا تزال غير مفهومة". "بينما لا يزال هناك الكثير من العمل الذي يتعين القيام به ، ستساعد دراستنا في دفع المجال إلى الأمام للحصول على فهم أفضل لكيفية التعبير عن جيناتنا في الوقت والمكان المناسبين ، الأمر الذي له تداعيات خطيرة على صحة الإنسان."

المرجع: & # 8220 أدوار متعددة لـ H2A.Z في تنظيم بنية الكروماتين المحفز في الخلايا البشرية & # 8221 بقلم لورين كول وسيباستيان كورشيد وماكسيم نيكراسوف وريناي دوماشينز ودانييل إل فيرا وجوناثان إتش دينيس وديفيد ج.تريميثيك ، 5 مايو 2021 ، اتصالات الطبيعة.
DOI: 10.1038 / s41467-021-22688-x

المؤلفون الآخرون في الورقة هم سيباستيان كورشيد ، مكسيم نيكراسوف وريناي دوماشين من الجامعة الوطنية الأسترالية ، ودانيال فيرا ، طالب دراسات عليا سابق في جامعة ولاية فرجينيا وهو الآن زميل باحث في كلية الطب بجامعة هارفارد.

المزيد عن SciTechDaily

الجينوم البشري في سن العشرين: كيف أدى الاختراق الأكثر شيوعًا في علم الأحياء إلى منع الانهيار والاعتقالات

أظهرت دراسة من جامعة كاليفورنيا أن إصابات الرأس يمكن أن تغير مئات الجينات

MIT & # 8217s خريطة شاملة لجينوم SARS-CoV-2 وتحليل ما يقرب من 2000 طفرة COVID

& # 8220Area X & # 8221 من Zebra Finch قد تقدم رؤى لاضطرابات الكلام البشري

هل جينات الذكور من المريخ ، جينات أنثوية من الزهرة؟ الفروق بين الجنسين في الصحة والمرض

يمكن أن تكون الجينات "المخفية" في البكتيريا مفتاحًا لتطوير مضادات حيوية جديدة

إمكانات ومخاطر تقنية كريسبر: هل تستحق كريسبر المخاطرة؟

استخدام سمك الزرد لفك رموز أدوار الجينات المرتبطة بالتوحد

تعليقان على "اكتشاف المفتاح حول كيفية تشغيل الجينات وإيقاف تشغيلها - & # 8220 الآثار الحرجة على صحة الإنسان & # 8221"

بابو ج. رانجاناثان *
(بكالوريوس الكتاب المقدس / علم الأحياء)

كيف يحول الحمض النووي الخلية إلى غنم أو طير أو إنسان؟

عندما تقسم كعكة ، لا تكبر الكعكة أبدًا. ومع ذلك ، عندما كنا مجرد خلية واحدة وتلك الخلية استمرت في الانقسام ، أصبحنا أكبر. يجب أن تأتي المواد الجديدة من مكان ما. جاءت تلك المواد الجديدة من الطعام.

تمامًا كما أن تسلسل الحروف والكلمات المختلفة في اللغة البشرية ينقل رسالة ويوجه العمال لبناء شيء ما وتجميعه ، كذلك فإن تسلسل الجزيئات المختلفة في حمضنا النووي (جيناتنا أو شفرتنا الجينية) يوجه الجزيئات من أمنا & # 8217s الغذاء الذي تلقيناه في الرحم ، لتصبح خلايا جديدة ، وتشكل في النهاية جميع أنسجة وأعضاء الجسم.

عندما تطعم قطة طعامك ، فإن الحمض النووي للقطط سيوجه جزيئات الطعام لتصبح خلايا وأنسجة وأعضاء قطة ، لكن الحمض النووي الخاص بك سيحول نفس الطعام إلى خلايا وأنسجة وأعضاء بشرية.

ما نسميه "الجينات" هو في الواقع أجزاء من جزيء الحمض النووي. عندما تفهم كيف يعمل الحمض النووي الخاص بك ، فإنك & # 8217ll تفهم أيضًا كيف يمكن أن يتحول صفار البيض إلى دجاج. اقرأ مقالتي الشهيرة على الإنترنت: كيف جعلني DNA الخاص بي؟ فقط جوجل العنوان للوصول إلى المقال.

ستمنحك هذه المقالة فهمًا جيدًا لكيفية استخدام الحمض النووي ، بالإضافة إلى الاستنساخ والهندسة الوراثية. تتعلم أيضًا أن ما يسمى بـ & # 8220Junk DNA & # 8221 ليس غير مهم على الإطلاق. سوف تتعلم لماذا ليس من المنطقي الاعتقاد بأن شفرة الحمض النووي يمكن أن تكون قد نشأت عن طريق الصدفة. يشير العلم (لا يثبت ، لكنه يشير) إلى سبب ذكي لشفرة الحمض النووي.

ماذا عن التشابه الجيني والبيولوجي بين الأنواع؟ المعلومات الجينية ، مثل أشكال المعلومات الأخرى ، لا يمكن أن تحدث عن طريق الصدفة ، لذلك فمن المنطقي أكثر أن نعتقد أن أوجه التشابه الجينية والبيولوجية بين جميع أشكال الحياة ترجع إلى مصمم مشترك صمم وظائف مماثلة لأغراض مماثلة. لا يعني ذلك & # 8217t أن جميع أشكال الحياة مرتبطة بيولوجيًا! فقط التشابهات الجينية داخل الأنواع الطبيعية تثبت العلاقة لأنها & # 8217s فقط داخل الأنواع الطبيعية التي يمكن للأعضاء التزاوج والتكاثر.

لا تستطيع الطبيعة بناء كود الحمض النووي من الصفر. يتطلب الأمر رمز DNA الموجود بالفعل لتوجيه وإحداث المزيد من كود DNA أو مهندس جيني في المختبر باستخدام تصميم ذكي وتكنولوجيا متطورة للغاية لإحضار رمز DNA إلى الوجود من الصفر. علاوة على ذلك ، فإن الحمض النووي الريبي / الحمض النووي والبروتينات يعتمدان على بعضهما البعض (لا يمكن للمرء أن يأتي إلى الوجود دون الاثنين الآخرين) ولا يمكنه & # 8220 البقاء على قيد الحياة & # 8221 أو العمل خارج خلية كاملة ومعيشية. كود الحمض النووي مدين بوجوده لأول مهندس جيني & # 8211 الله!

تتطلب جزيئات البروتين أن تتجمع الأحماض الأمينية المختلفة في تسلسل دقيق ، تمامًا مثل الحروف في الجملة. إذا لم تكن & # 8217re في التسلسل الصحيح ، فإن البروتين سيفوز بوظيفة & # 8217t. يتطلب كل من DNA و RNA أن تكون أحماضهما النووية المختلفة في التسلسل الصحيح.

علاوة على ذلك ، هناك أحماض أمينية أعسر ويمنى وهناك أحماض نووية أعسر وأيمن. تتطلب جزيئات البروتين أن تكون جميع أحماضها الأمينية أعسر فقط وبالتسلسل الصحيح. يتطلب الحمض النووي والحمض النووي الريبي أن تكون جميع أحماضهما النووية في اليد اليمنى وبالتسلسل الصحيح. سيستغرق ظهور DNA و RNA والبروتينات بالصدفة معجزة!

قال علماء الرياضيات إن أي حدث في الكون له احتمالية من 10 إلى 50 قوة أو أكبر أمر مستحيل! احتمال ظهور جزيء بروتين متوسط ​​الحجم (مع أحماضه الأمينية في التسلسل الصحيح) بالصدفة هو 10 أس 65. حتى أبسط خلية تتكون من عدة ملايين من جزيئات البروتين المختلفة جنبًا إلى جنب مع DNA / RNA ..

قدر العالم البريطاني العظيم الراحل السير فريدريك هويل أن احتمالات ظهور أبسط خلية بالصدفة هي 10 أس 40 ألف! ما هو حجم هذا؟ ضع في اعتبارك أن العدد الإجمالي للذرات في كوننا هو 10 أس 82.

أيضًا ، ما يسمى بـ & # 8220Junk DNA & # 8221 isn & # 8217t junk. على الرغم من أن هذه الأجزاء & # 8220-non-coding & # 8221 من الحمض النووي لا تحتوي على رمز للبروتينات ، فقد وُجد مؤخرًا أنها ضرورية في تنظيم التعبير الجيني (أي متى وأين وكيف يتم التعبير عن الجينات ، لذا فهي ليست كذلك & # 8220 زبدة و # 8221). أيضًا ، هناك دليل على أنه في مواقف معينة ، يمكنهم ترميز البروتينات من خلال استخدام الخلية لآلية "قراءة كاملة" معقدة.

قم بزيارة آخر موقع لي على الإنترنت: الخلق الداعم للعلم (يجيب هذا الموقع على العديد من الحجج ، القديمة والجديدة ، التي استخدمها أنصار التطور لدعم نظريتهم)

مؤلف المقال الشهير على الإنترنت ، عقيدة الجحيم التقليدية تطورت من الجذور اليونانية

* لقد ألقيت محاضرات ناجحة (مع فترة أسئلة وأجوبة بعد ذلك) للدفاع عن الخلق أمام أعضاء هيئة التدريس في العلوم التطورية والطلاب في مختلف الكليات والجامعات. لقد تشرفت بالاعتراف في الإصدار الرابع والعشرين من Marquis & # 8220Who & # 8217s Who in The East. & # 8221


كود الحمض النووي للأنسولين

يوجد أدناه تسلسلين جزئيين لقواعد الحمض النووي (معروضان لخط واحد فقط من الحمض النووي) التسلسل 1 مأخوذ من الإنسان والتسلسل 2 من بقرة. في كل من البشر والأبقار ، يعد هذا التسلسل جزءًا من مجموعة من التعليمات للتحكم في إنتاج البروتين. في هذه الحالة ، يحتوي التسلسل على الجين لصنع بروتين الأنسولين. الأنسولين ضروري لامتصاص السكر من الدم. بدون الأنسولين ، لا يمكن لأي شخص استخدام سكريات الهضم بنفس الطريقة التي يستخدمها الآخرون ، ويكون لديهم مرض يسمى السكري.

  1. باستخدام تسلسل الحمض النووي الوارد في الجدول 1 ، اصنع خيطًا مكملًا من الحمض النووي الريبي للإنسان. اكتب RNA مباشرة أسفل خيط DNA (تذكر أن تستبدل U بـ T في RNA).
  2. كرر الخطوة 1 للبقرة. اكتب الحمض النووي الريبي مباشرة أسفل خيط الحمض النووي في الجدول 2.
  3. استخدم جدول الكودون في كتابك لتحديد الأحماض الأمينية التي يتم تجميعها لصنع بروتين الأنسولين في كل من البقرة والإنسان. اكتب سلسلة الأحماض الأمينية مباشرة أسفل تسلسل الحمض النووي الريبي.

تسلسل 1 الإنسان
الحمض النووي C C A T A G C A C G T A C A C A C G T G A A G G T A A
RNA
أحماض أمينية

تسلسل 1 بقرة
الحمض النووي C C G T A G C A T G T A C A C A C G C G A A G G C A C
RNA
أحماض أمينية

1. يختلف تسلسل الحمض النووي للبقرة والإنسان ، لكن سلسلة الأحماض الأمينية التي ينتجها التسلسل هي نفسها تقريبًا. كيف يمكن أن يحدث هذا؟

2. مرض السكري هو مرض يتسم بعدم القدرة على تكسير السكريات. غالبًا ما يعاني الشخص المصاب بداء السكري من خلل في تسلسل الحمض النووي الذي يرمز إلى صنع بروتين الأنسولين. لنفترض أن شخصًا ما لديه طفرة في الحمض النووي الخاص به ، وأن أول مجموعة ثلاثية لترميز الجينات للأنسولين هي C C C (بدلاً من C C A). حدد الحمض الأميني الذي ترمز إليه الرموز الثلاثية الجديدة للحمض النووي. هل سيكون هذا الشخص مصابا بمرض السكر؟

3. ماذا لو كان الثلاثي الأول هو C A A؟

4. كيف يمكن لشفرة تتكون من أربعة أحرف فقط ، كما هو الحال في DNA (A ، T ، G ، C) تحديد جميع الأجزاء المختلفة للكائن الحي وتفسير كل تنوع الكائنات الحية على هذا الكوكب؟

غالبًا ما تستخدم تسلسل الحمض النووي لتحديد العلاقات بين الكائنات الحية. يمكن أن تختلف تسلسلات الحمض النووي التي ترمز لجين معين على نطاق واسع. الكائنات الحية التي ترتبط ارتباطًا وثيقًا سيكون لها تسلسلات متشابهة. فيما يلي قائمة بالتسلسلات لعدد قليل من الكائنات الحية:

بشر CCA TAG CAC CTA
شخص شره CCA TGG AAA CGA
شمبانزي CCA TAA CAC CTA
كريكيت CCT AAA GGG ACG

5. بناءً على التسلسل ، ما هي الكائنات الحية الأكثر ارتباطًا؟

6. تم العثور على كائن حي غير معروف في الغابة ، والجين متسلسل ، ووجد أنه C C A T G G A A T C G A ، ما هو نوع الحيوان الذي تعتقد أنه هذا؟


الداعم بوند

كان العلماء في الاتحاد السوفيتي أول من اكتشف Z-DNA ، في أواخر السبعينيات ، في فجوة تسمى S-2L ، والتي تصيب بكتيريا التمثيل الضوئي 4. ووجدوا أن الحمض النووي للعاثية يتصرف بشكل غريب عندما انصهر خيوطه الحلزونية. تتكسر الرابطة التي تتشكل بين قاعدتي G و C عند درجة حرارة أعلى ، مقارنة بتلك الرابطة A و T ، ويتصرف الحمض النووي للعاثية كما لو كان مصنوعًا بشكل أساسي من G و C. لكن التحليل الإضافي الذي أجراه الفريق السوفيتي أظهر أن العاثية استبدلت A بـ Z ، والتي شكلت رابطة أقوى مع T.

يقول فيليب مارليير ، المخترع وعالم الوراثة بجامعة إيفري بفرنسا ، الذي قاد إحدى علم دراسات. "لماذا هذه العاثية لها قاعدة خاصة مثل هذه؟"

يلمح العلماء ميكروب غريب الأطوار يمكن أن يساعد في تفسير نشوء الحياة المعقدة

أظهرت دراسات المتابعة أن جينوم القلب S-2L كان مقاومًا للإنزيمات المضغوطة للحمض النووي وغيرها من الدفاعات المضادة للعاثيات التي تستخدمها البكتيريا. لكن الباحثين لم يعرفوا كيف يعمل نظام Z-DNA أو ما إذا كان شائعًا. Z-DNA هو واحد فقط من مجموعة من التعديلات المعروفة بوجودها في DNA phage.

للإجابة على هذه الأسئلة ، قام فريق بقيادة مارليير وبيير ألكسندر كامينسكي ، عالم الكيمياء الحيوية في معهد باستير في باريس ، بتسلسل جينوم العاثية في أوائل القرن الحادي والعشرين. لقد اكتشفوا الجين الذي يحتمل أن يكون متورطًا في خطوة واحدة لصنع Z-DNA ، ولكن ليس في خطوات أخرى. لكن التسلسل لم يكن له تطابقات في قواعد البيانات الجينومية في ذلك الوقت ، ووصل سعي الفريق لفهم أساس Z-DNA إلى طريق مسدود.

حصل مارليير وزملاؤه على براءة اختراع جينوم S-2L ، لكنهم قاموا أيضًا بنشره ، واستمر في البحث عن قواعد البيانات الجينومية. أخيرًا ، في عام 2015 ، حصل الفريق على إصابة: فجوة تصيب البكتيريا المائية من الجنس فيبريو يحتوي على جين يطابق امتداد جينوم S-2L. قام الجين بتشفير إنزيم يشبه الإنزيم الذي تستخدمه البكتيريا لصنع الأدينين. تقول مارليير: "لقد كانت لحظة مبهجة".

في عام 2019 ، وجد فريق Zhao تطابقات مماثلة لقاعدة البيانات. أظهر كلا الفريقين أن العاثيات جميعها لديها جين يسمى PurZ. يرمز هذا الإنزيم إلى إنزيم يلعب دورًا مبكرًا ولكنه حاسم في صنع نوكليوتيد Z من جزيء سلائف موجود في الخلايا البكتيرية. ثم حددوا إنزيمات إضافية - مشفرة في جينومات البكتيريا التي تصيبها العاثيات - والتي تكمل المسار.

السلاح السري للحمض النووي ضد العقد والتشابك

لكن السؤال الرئيسي ظل قائما. أنتجت الإنزيمات التي حددتها الفرق المكونة الخام لـ Z-DNA - وهو جزيء يسمى dZTP - ولكن هذا لم يفسر كيف تقوم العاثيات بإدراج الجزيء في خيوط الحمض النووي ، مع استبعاد القواعد A (في شكل مادة كيميائية تسمى dATP).

هنا ، اختلفت استنتاجات الفريق بشكل طفيف. جنبا إلى جنب مع PurZ في فيبريو يقع جينوم العاثية في جين يصنع إنزيمًا يسمى بوليميراز ، والذي ينسخ خيوط الحمض النووي. وجد Marlière و Kaminski أن بوليميراز الملتهمة يدمج dZTP في الحمض النووي ، بينما يستبعد أي قواعد A تم إدخالها. يقول كامينسكي: "هذا أوضح لنا سبب استبعاد" أ ". "كان هذا مذهلاً حقًا."

يعتقد تشاو أن هذه ليست القصة كاملة. يقترح عملها أن هناك حاجة إلى إنزيم فجائي آخر ، يقوم بتفتيت dATP ولكنه يحافظ على dZTP داخل الخلايا. وجد فريقها أن زيادة مستويات dZTP بالنسبة إلى مستويات dATP كانت كافية لخداع البوليميراز الخاص بالخلية لصنع Z-DNA.


الفرق بين تخليق البروتين وتكرار الحمض النووي

توفر البروتينات والحمض النووي التصميم الأساسي للحفاظ على الحياة على الأرض. في الواقع ، تحدد البروتينات شكل ووظائف الكائنات الحية بينما يحتفظ الحمض النووي بالمعلومات اللازمة لذلك. ومن ثم ، يمكن فهم تخليق البروتين وتكرار الحمض النووي على أنهما عمليات بالغة الأهمية تحدث في الخلايا الحية.تبدأ هاتان العمليتان من تسلسل النوكليوتيدات في حبلا الحمض النووي ، لكن هذه مسارات مختلفة. يتم شرح الخطوات المهمة لكلتا العمليتين ، وتناقش الاختلافات بينهما في هذه المقالة.

تخليق البروتين

تخليق البروتين هو عملية بيولوجية تحدث داخل خلايا الكائنات الحية في ثلاث خطوات رئيسية تُعرف باسم النسخ ، ومعالجة الحمض النووي الريبي ، والترجمة. في خطوة النسخ ، يتم نسخ تسلسل النوكليوتيدات للجين في خيط DNA إلى RNA. هذه الخطوة الأولى تشبه إلى حد كبير تكرار الحمض النووي باستثناء أن النتيجة هي حبلا على الحمض النووي الريبي في تخليق البروتين. يتم تفكيك خيط الحمض النووي باستخدام إنزيم هليكاز الحمض النووي ، ويتم إرفاق بوليميراز الحمض النووي الريبي في المكان المحدد لبداية الجين المعروف باسم المروج ، ويتم تصنيع حبلا الحمض النووي الريبي على طول الجين. يُعرف حبلا RNA الذي تم تشكيله حديثًا باسم messenger RNA (mRNA).

يأخذ حبلا الرنا المرسال تسلسل النوكليوتيدات إلى الريبوسومات من أجل معالجة الحمض النووي الريبي. سوف تتعرف جزيئات الحمض النووي الريبي (نقل الحمض النووي الريبي) المحددة على الأحماض الأمينية ذات الصلة في السيتوبلازم. بعد ذلك ، يتم ربط جزيئات الحمض النووي الريبي (tRNA) بالأحماض الأمينية المحددة. في كل جزيء tRNA ، هناك سلسلة من ثلاثة نيوكليوتيدات. يتم توصيل الريبوسوم الموجود في السيتوبلازم بحبل الرنا المرسال ، ويتم تحديد كودون البداية (المحفز). يتم نقل جزيئات الحمض الريبي النووي النقال مع النيوكليوتيدات المقابلة لتسلسل الرنا المرسال إلى الوحدة الفرعية الكبيرة للريبوسوم. عندما تصل جزيئات الحمض النووي الريبي (tRNA) إلى الريبوسوم ، يرتبط الحمض الأميني المقابل بالحمض الأميني التالي في التسلسل من خلال رابطة الببتيد. تُعرف هذه الخطوة الأخيرة بالفعل باسم الترجمة ، وهذا هو المكان الذي يحدث فيه تخليق البروتين الفعلي.

يتم تحديد شكل البروتين من خلال أنواع مختلفة من الأحماض الأمينية في السلسلة ، والتي تم ربطها بجزيئات الحمض النووي الريبي ، لكن الحمض النووي الريبي (tRNA) خاص بتسلسل الرنا المرسال. ومن ثم ، فمن الواضح أن جزيئات البروتين تصور المعلومات المخزنة في جزيء الحمض النووي. ومع ذلك ، يمكن البدء في تخليق البروتين من خيط RNA أيضًا.

تكرار الحمض النووي

تكرار الحمض النووي هو عملية إنتاج شريطين متطابقين من الحمض النووي من واحد ، ويتضمن سلسلة من العمليات. تحدث كل هذه العمليات خلال المرحلة S من الطور البيني لدورة الخلية أو انقسام الخلية. إنها عملية مستهلكة للطاقة ، وتشارك في تنظيم هذه العملية في المقام الأول ثلاثة إنزيمات رئيسية تُعرف باسم DNA Helicase و DNA polymerase و DNA ligase. أولاً ، تقوم هيليكاز DNA بتفكيك البنية الحلزونية المزدوجة لشريط الحمض النووي عن طريق كسر الروابط الهيدروجينية بين القواعد النيتروجينية للخيوط المتعارضة. يبدأ هذا التفكيك من نهاية خيط DNA وليس من المنتصف. لذلك ، يمكن اعتبار هليكاز الحمض النووي بمثابة نوكلياز خارجي مقيد.

بعد تعريض القواعد النيتروجينية للحمض النووي المفرد الذي تقطعت به السبل ، يتم ترتيب ديوكسي ريبونوكليوتيدات المقابلة وفقًا لتسلسل القاعدة وتتكون الروابط الهيدروجينية ذات الصلة بواسطة إنزيم بوليميريز الحمض النووي. تحدث هذه العملية الخاصة على كل من خيوط الحمض النووي. أخيرًا ، تتشكل روابط الفوسفوديستر بين النيوكليوتيدات المتتالية ، لإكمال خيط DNA باستخدام إنزيم DNA ligase. في نهاية كل هذه الخطوات ، يتم تكوين خيطين متطابقين من الحمض النووي من خيط DNA أم واحد فقط.

الفرق بين تخليق البروتين وتكرار الحمض النووي


نقاش

إنزيمات PLD-superfameric الأحادية مثل Tdp1 البشري و PLD من أنواع Streptomyces (12 ، 13) عبارة عن مونومرات ثنائية الفصوص (الشكل 1 أ) تحتوي في الموقع النشط على اثنين من بقاياه من أشكال تسلسل "HXK" المكررة الموجودة بعيدًا في سلسلة البروتين. هيستيدينات الموقع النشط لهذه الإنزيمات ليست مكافئة وتؤدي أدوارًا محددة مسبقًا في التحفيز. واحد خاص له يتصاعد هجوم nucleophilic على الفوسفات scissile لجعل وسيطة تساهمية (الشكل 1B). ليس من المستغرب أن يؤدي استبداله بطفرات موجهة بالموقع إلى جعل الإنزيم غير نشط تمامًا (13 ، 16 ، 26). يلعب الآخر دورًا داعمًا - فهو يقوم ببروتونات المجموعة الخارجة أثناء التكوين الوسيط التساهمي وبالتالي يسهل التحلل المائي لرابط الفوسفوهستيدين. غالبًا ما تؤدي الطفرات في بقايا الهيستيدين الأخيرة إلى إضعاف النشاط التحفيزي وتؤدي إلى تراكم الوسيط التساهمي (27).

إن نوكليازات عائلة PLD المميزة هيكليًا - Nuc ونوكلياز التقييد BfiI (10 ، 14) - عبارة عن محولات متجانسة تحتوي على موقع نشط واحد مشابه هيكليًا لموقع Tdp1 البشري و PLD من أنواع Streptomyces. ومع ذلك ، على عكس إنزيمات PLD الأحادية ، فإن الموقع النشط لـ BfiI متماثل تمامًا ، حيث يحتوي على اثنين من مخلفاته مرتبطة بمحور التناظر ثنائي الطي للثنائي ، كل منها تبرع به وحدة فرعية إنزيم (الشكل 1 أ). هذا يحول دون تخصيص الأدوار الفردية لكل من بقاياه في التحفيز. لحل هذه المشكلة ، قمنا بتعطيل التماثل الثنائي الجوهري لـ BfiI من خلال بناء أشكال غير متجانسة من الإنزيم (الشكل 2).

أدوار هيستيدين الموقع النشط في الحفز

يشكل WT BfiI الوسيط التساهمي على ركائز الفسفوروثيولات المقطوعة و 3′- فوسفوروثيولات بمعدلات مماثلة (2.1 و 7.7 ثانية -1 ، على التوالي: الشكل 3E) ، على الرغم من المجموعة التي تترك أكثر حمضية بكثير من الركيزة 3′-فوسفوروثيولات [pKأ قيم مجموعتي 3′-SH و 3′-OH هي 11 و 16 ، على التوالي (28)] ، مما يشير إلى أن بروتونات المجموعة المغادرة 3′ ليست عاملاً محددًا لمعدل WT BfiI. تتناقض قدرة BfiI على شق رابط 3′-phosphorothiolate بسرعة أكبر من الركيزة التي تحتوي على الأكسجين بالكامل مع معظم النيوكليازات المعتمدة على المعدن (5 ، 29 ، 30). يتم تثبيط هذه الإنزيمات ، على عكس BfiI المستقل المعدني ، عن طريق استبدال 3′-S نظرًا لتفاعلها الضعيف بين أيونات Mg 2+ مع الكبريت ، ومع ذلك ، يتم إنقاذ بعض هذه الإنزيمات بواسطة أيون ثيوفيليك Mn 2+ (5 ، 29) ).

أدى استبدال أحد الهيستيدات في الموقع النشط مع الألانين ، في مغاير WT / H105A ، إلى انخفاض كبير بمقدار 10 6 أضعاف في معدل انقسام رابطة أوكسيستر في أوليجودوبليكس 14/15 (الشكل 3E). يمكن أن يكون النشاط المتبقي ناتجًا عن كمية صغيرة من WT BfiI الموجودة في عينة مغاير مغاير ولكن الاستعدادات المختلفة من heterodimer ، بما في ذلك المتغيرات البديلة WT (6His) / H105A و H105A (6His) / WT ، أعطت جميعها نفس المستوى المنخفض مستوى النشاط. لذلك ، من المرجح أن يكون النشاط المرصود جوهريًا في مغاير WT / H105A. وبالتالي ، فإن بقايا His105 الثانية في الموقع النشط لـ BfiI تسرع من تكوين الوسيط التساهمي على ركيزة الفوسفوديستر بمعامل لا يقل عن 10 6.

اللافت للنظر ، أن المغير المتغاير قام بتقسيم ارتباط 3′-phosphorothiolate في 14 / 15s مزدوج الاتجاه 10 5 أضعاف بسرعة أكبر من مجموعة phosphodiester في الركيزة الأصلية 14/15 (الشكل 3E). المعدل الناتج للتكوين الوسيط التساهمي بواسطة heterodimer (0.19 s 1) أقل بمقدار 40 ضعفًا فقط من معدل إنزيم WT على نفس الركيزة (7.7 s −1 ، الشكل 3E). علاوة على ذلك ، فإن تحسين المعدل فوق ركيزة الأكسجين بالكامل بمعامل 10 5 يتزامن مع pKأ الفرق بين مجموعات ترك 3′-OH و 3′-SH [5 وحدات (28)]. تجادل هذه الملاحظات بأن إحدى البقايا البنائية H105 في WT homodimer لـ BfiI تقوم ببروتونات المجموعة 3′ أثناء خطوة التفاعل الأولى (الشكل 1B): عند إزالتها ، في WT / H105A مغاير ، استقرار القاعدة المترافقة من مجموعة ترك 3′ يصبح عاملاً رئيسياً يتحكم في معدل التفاعل. يشير الاختلاف في المعدل بين إنزيمات WT غير المتجانسة على الركيزة 3′-phosphorothiolate إلى أنه حتى المجموعة التي تترك 3′-thio الحمضية نسبيًا يجب أن يتم بروتوناتها لتحقيق أقصى معدل للتكوين الوسيط التساهمي.

الخطوة الثانية في التفاعل ، التحلل المائي للإنزيم التساهمي - الحمض النووي الوسيط (الشكل 1 ب) ، هي عملية سريعة للغاية لـ WT BfiI (ك2 = 170 ثانية -1 ، الشكل 3 هـ). ومع ذلك ، ينخفض ​​المعدل بمعامل قدره 17000 لمغاير WT / H105A (ك2 = 0.010 ث -1). يؤكد التأثير الدراماتيكي لاستبدال H105A على المشاركة المباشرة للحامض النشط الثاني للموقع النشط في التحلل المائي للوسيط التساهمي الفوسفوهيستيدين ، ويفترض أن الهيستيدين الثاني ينشط جزيء الماء الذي يحلل الوسيط عن طريق إزالة بروتون (الشكل 1 ب).

يؤدي الاستبدال الفردي H105A أيضًا إلى عكس نسبة معدلات التفاعل للتكوين (ك1) والاضمحلال (ك2) من الوسيط التساهمي. بالنسبة إلى WT BfiI على الركيزة 14 / 15s ، فإن نسبة ك12 هو 0.05 ، أي أن الوسيط التساهمي يتشكل 20 مرة أبطأ مما يتحلل بالماء. بالنسبة للمقاييس المتغايرة WT (6His) / H105A و H105A / WT-N ، فإن نسبة ك12 هو ≥20 ، مما يؤدي إلى تراكم الوسيط التساهمي أثناء التفاعل (الشكلان 3 ج و 4 أ). أشار التحليل البيوكيميائي للأنواع منخفضة الحركة المفترضة على أنها وسيطة تساهمية (بيانات تكميلية) إلى أن هذا هو التقريب الفوسفوريستيدين المتوقع. يتكون الوسيط التساهمي فقط من النوع البري ولكن ليس الوحدة الفرعية H105A من المغير المتغاير (البيانات التكميلية). علاوة على ذلك ، كما هو متوقع بالنسبة لمركب الفوسفوهستيدين (22 ، 24) ، فإن إضافة BfiI-DNA مستقرة عند درجة الحموضة القلوية ولكنها تتحلل في الحمض (بيانات تكميلية).

آلية جديدة لانقسام الحمض النووي المزدوج تقطعت بهم السبل

غالبًا ما تحتوي نوكليازات التي تقطع الحمض النووي المزدوج الشريطة على وحدتين فرعيتين متطابقتين مرتبطتين بالتناظر الدوراني ، بحيث يشق الموقع النشط من وحدة فرعية واحدة الضفيرة 5′ - 3 بينما يهاجم ذلك من الوحدة الفرعية ذات الاتجاه المعاكس المضاد الموازي 3′-5 ′ حبلا (7). ومع ذلك ، لا يمكن تعميم هذه الاستراتيجية لجميع النيوكليزات التي تعمل على الحمض النووي مزدوج الشريطة. عدد من الإنزيمات بما في ذلك نوكلياز داخلي موجه I-TevI ​​(31) ، مجمع RecBCD لـ بكتريا قولونية يستخدم كل من (32) وإنزيم تقييد BfiI (17) موقعًا نشطًا واحدًا لقطع كل من خيوط الحمض النووي ، على الرغم من القطبين المعاكسين.

نوكلياز I-TevI ​​المشفر intron هو مونومر ويحتوي على موقع نشط واحد ولكنه يقطع كل من خيوط الحمض النووي في موقع المستلم لتوجيه الإنترون ، ويترك في كلتا الحالتين منتجات تحتوي على 3′-hydroxyl و 5′-phosphate termini (33) . يُعتقد أنه أولاً يشق رابطة الفوسفوديستر المستهدفة في الخصلة السفلية ثم يشوه الحمض النووي لتوجيه الفوسفات المقطعي من الشريط العلوي إلى الموقع النشط (31). ومع ذلك ، لم يتضح بعد كيف يمكن لموقعه النشط الوحيد أن يستوعب ويقطع روابط الفوسفوديستر من كل من خيوط الحمض النووي 3-5-5 و 5′-3 ، كما في كلتا الحالتين يجب أن تحل محل المجموعة المغادرة على الجانب 3 من الفوسفور في الرابطة المقصية: أي في اتجاهين متعاكسين على 3′ –5 مقارنة بالخيط 5′ – 3. علاوة على ذلك ، نظرًا للتركيب البلوري للمجال التحفيزي لـ I-TevI ​​، لا يمكن استبعاد مخططات التفاعل البديلة ، بما في ذلك التباين العابر (34). يتضمن أسلوب عمل نوكلياز داخلي أحادي آخر ، FokI ، تقطيعًا عابرًا (35 ، 36) ، لإعطاء مجموعة بروتينية في موقع التعرف مع مجالين محفزين متجاورين في محاذاة مضادة متوازية (37 ، 38) ، كل منهما يقطع حبلاً واحدًا من الحمض النووي. في هذه الحالة ، المونومر 1 ° المرتبط مباشرة بموقع التعرف يشق الخصلة السفلية بينما المونومر 2 ° المعين إلى الموقع عن طريق تفاعلات البروتين والبروتين يقطع الشريط العلوي (25) ، لكن التناظر داخل ثنائيات المجالات التحفيزية ( 37) يمكن أحدهما من قطع الخيط 3′ –5 والآخر 5′ – 3.

ال بكتريا قولونية يعمل إنزيم RecBCD في إصلاح تكسر الحمض النووي المزدوج الشريطة كبروتين ثلاثي مع أنشطة تحفيزية متعددة تتضمن وظيفتين من نوع هيليكس ، كلاهما 3 ′ → 5 و 5 → 3 ′ في الوحدتين الفرعيتين B و D على التوالي ووظيفة نوكلياز واحدة ، وتقع في B حيث تتحلل من كلا الخيوط (32). لتفسير كيفية انشقاق نوكلياز كل من الخيوط التي تم فكها حديثًا على الرغم من الأقطاب المعاكسة لهما ، تم اقتراح أن الطرف 3′ الناشئ الذي تم إنشاؤه بواسطة RecB يتقدم مباشرة إلى مركز نوكلياز ، والذي يوجد أيضًا في B ، بينما الوليدة 5′- تشكل النهاية التي تم إنشاؤها بواسطة RecD حلقة قبل دخول مركز نوكلياز بنفس اتجاه 3′ –5 مثل 3′-strand (39). ومع ذلك ، لم يتم تأكيد هذا النموذج تجريبيًا بعد ، على الرغم من أنه يمكن التوفيق بسهولة مع التركيب البلوري لـ RecBCD (40).

يستخدم إنزيم تقييد BfiI استراتيجية أخرى. لقد ثبت سابقًا أنه يستخدم موقعًا نشطًا واحدًا لقطع كل من خيوط الحمض النووي في اتجاه مجرى موقع التعرف الخاص به في خطوات متسلسلة ، بترتيب ثابت أولاً في الجزء السفلي ثم الشريط العلوي فقط (17). يحتوي نوكلياز BfiI على اثنين من مخلفاته موضوعة بشكل متماثل في الموقع النشط ، لذلك تم اقتراح أن تقطع BfiI خيطًا واحدًا باستخدام الهيستيدين من وحدة فرعية واحدة مثل nucleophile وذلك من الوحدة الفرعية الأخرى كمانح / متقبل للبروتون ، في حين أن هذه الأدوار يتم عكسها لقطع الشريط التكميلي للقطبية المعاكسة (17).

في هذه المقالة ، تم اختبار هذه الفرضية بشكل تجريبي باستخدام مغاير مغايرة مقطوعة من BfiI التي تفتقر إلى مجال ربط الحمض النووي من وحدة فرعية واحدة: إما من الوحدة الفرعية التي تحمل طفرة H105A المعطلة ، WT / H105A-N أو من الوحدة الفرعية WT ، H105A / WT -ن. على عكس المغايرات ذات الطول الكامل التي تحمل مجالات التعرف على الحمض النووي (الشكل ثلاثي الأبعاد) ، يجب على كل مغاير مغاير مقطوع ربط الحمض النووي في اتجاه محدد: إما الاتجاه الإنتاجي الذي يتم فيه وضع بقايا His105 من الوحدة الفرعية WT للهجوم المباشر على الفوسفات المقطعي أو الاتجاه غير المنتج حيث تكون البقايا الموجودة في موضع الهجوم المباشر هي الألانين من الوحدة الفرعية H105A (الشكل 4 أ و ب). ومن ثم ، إذا أظهر مغاير WT / H105-N نشاطًا تحفيزيًا ، يتم تكوين الوسيط التساهمي بواسطة الهيستيدين من الوحدة الفرعية للإنزيم كامل الطول المرتبطة بالموقع المستهدف على الحمض النووي ، الوحدة الفرعية 1 درجة. بدلاً من ذلك ، إذا كان متغير H105A / WT-N يعرض نشاطًا ، فإن nucleophile الهيستيدين يأتي من الوحدة الفرعية المقطوعة غير المرتبطة بتسلسل التعرف ، الوحدة الفرعية 2 °. وهكذا ، من خلال تحليل أنشطة heterodimers المقطوعة ، تمكنا من تحديد بقايا الهيستيدين التي تشكل الوسيط التساهمي أثناء انقسام القاع (3 –5 ′) والجزء العلوي (5′ –3) خيوط الحمض النووي.

على عكس الاقتراح القائل بأن H105 من وحدة فرعية معينة من BfiI تهاجم الرابطة المقصية في خيط DNA السفلي (3 –5 ′) بينما يأخذ H105 المرتبط بالتناظر من الوحدة الفرعية المعاكسة هذا الدور لقطع الجزء العلوي (5′ 3 ′) ، تم العثور هنا على وحدة His من الوحدة الفرعية 2 ° غير المرتبطة بموقع التعرف على الهجمات بالتتابع على روابط phosphodiester المستهدفة في كل من خيوط 3′ 5 و 5 3. يُفترض أن الهستيدين المكافئ من الوحدة الفرعية 1 درجة المرتبطة بالحمض النووي يعمل كمانح / متقبل للبروتون للتفاعلات على كلا الخيوط. لمطابقة القطبية المضادة المتوازية لجدلي الحمض النووي ، يجب أن يدور المركز التحفيزي لـ BfiI بمقدار 180 درجة بين تفاعلين التحلل المائي (الشكل 4C). وبالتالي ، نوضح هنا آلية جديدة لقطع الحمض النووي مزدوج الشريطة لأنه يتطلب موقعًا نشطًا واحدًا ليس فقط للتبديل بين السلاسل ولكن أيضًا لتبديل اتجاهه على الحمض النووي.

تحتوي جميع التفاعلات المذكورة أعلاه على BfiI بشكل زائد عن الحمض النووي ، لتفضيل ارتباط جزيء DNA واحد بكل ثنائي إنزيم. ومع ذلك ، فإن BfiI نشطة على النحو الأمثل عند ربطها بنسختين من تسلسل التعرف الخاص بها (18). لقطع أربعة روابط فسفودايستر عبر موقعين مستهدفين ، يجب أن ينتقل الموقع النشط الوحيد في ثنائي فوسفات BfiI بين الفوسفات المقطعي في الموقعين ، مما يؤدي إلى شق رابطة فسفودايستر واحدة في المرة الواحدة. في المركب المشبكي لـ BfiI dimer مع موقعين للتعرف (الشكل 4D) ، يتم إرفاق وحدة فرعية واحدة (B) عبر مجال ربط الحمض النووي الخاص بها إلى موقع التعرف X بينما يتم توصيل الوحدة الفرعية الأخرى (A) بالموقع Y. هذا يترك الوحدة الفرعية A كوحدة فرعية 2 ° فيما يتعلق بموقع التعرف X لذلك يُفترض أن H105 من A يشكل الوسيط التساهمي أثناء القطع المتسلسل لكلا الجدائل في الموقع X ، بينما يفي H105 من الوحدة الفرعية B بأدوار المتبرع / المستقبِل للبروتون في كل من أحداث قص حبلا . على العكس من ذلك ، الوحدة الفرعية B هي الوحدة الفرعية 2 ° للموقع Y لذلك ، لقطع هذا الموقع الثاني ، يجب أن تؤدي بقايا H105 من الوحدتين الفرعيتين B و A نفس الأدوار التي تلعبها ، على التوالي ، الوحدات الفرعية A و B عند القطع الموقع X. ومن ثم ، فإن بقاياه قد يتبادلان الأدوار أثناء شق موقعين محددين مرتبطين بديمر إنزيم (الشكل 4 د) ، على الرغم من أنه سيكون دائمًا هوستدين من وحدة فرعية معينة تهاجم كل من الخيوط السفلية والعلوية في كل موقع DNA ( الشكل 4 ج).


شاهد الفيديو: بناء البروتين النسخ والترجمة (يوليو 2022).


تعليقات:

  1. Zulkigis

    هذه مجرد عبارة لا مثيل لها ؛)

  2. Syman

    بالنسبة لي ليس من الواضح

  3. Trowbridge

    برافو ، جاءت الجملة بالمناسبة

  4. Archibaldo

    موقف مضحك



اكتب رسالة