معلومة

5.12: التخليق الحيوي - علم الأحياء

5.12: التخليق الحيوي - علم الأحياء


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

5.12: التخليق الحيوي

عالم الأحياء الحسابي @ NSW

وصف موجز للوظيفة: يجمع معهد غارفان للبحوث الطبية بين الأطباء والباحثين الأساسيين والمترجمين الرائدين عالميًا لكسر الحواجز بين التخصصات العلمية التقليدية وإيجاد حلول للأمراض. تأسست في عام 1963 ، تتمثل مهمة Garvan في تسخير جميع المعلومات المشفرة في الجينوم الخاص بنا لتشخيص المرض وعلاجه والتنبؤ به والوقاية منه بشكل أفضل.

يعمل علماؤنا عبر أربعة مواضيع بحثية متداخلة: الجينوميات الطبية ، وعلم التخلق ، وأمراض الجينوم الخلوية للمناعة والالتهابات ، وسرطان وأمراض الشيخوخة التي تصيب العظام والدماغ والتمثيل الغذائي. بالإضافة إلى ذلك ، يوجد لدى Garvan ثلاثة مراكز رئيسية: مركز Kinghorn لعلم الجينوم السريري ، ومركز Garvan-Weizmann لعلم الجينوم الخلوي ، ومركز علم الجينوم السكاني.

يقع هذا المنصب في مركز علم الجينوم السكاني (CPG) ، وهو مبادرة مشتركة بين معهد غارفان للأبحاث الطبية (غارفان) في سيدني ومعهد مردوخ لأبحاث الأطفال (MCRI) في ملبورن.

رؤية CPG هي عالم تتيح فيه المعلومات الجينومية إمكانية التنبؤ الشامل بالأمراض والتشخيص الدقيق والعلاجات الفعالة لجميع الأشخاص. الغرض من CPG هو: إقامة شراكات محترمة مع مجتمعات متنوعة ، وجمع البيانات الجينية وتحليلها على نطاق تحولي ودفع الاكتشاف الجيني والطب الجيني العادل في أستراليا.

يقود CPG خبراء في المشاركة المجتمعية ، وتطوير البرمجيات ، والتحليل الجيني وإدارة المشاريع. عمل المدير دانيال ماك آرثر سابقًا كمدير مشارك لعلم الوراثة الطبية والسكان في معهد برود التابع لمعهد ماساتشوستس للتكنولوجيا وجامعة هارفارد ، حيث قاد تطوير قاعدة بيانات تجميع الجينوم (gnomAD) ، وهي المجموعة الأكبر والأكثر استخدامًا لبيانات تسلسل الحمض النووي البشري. في العالم.

نحن نبحث عن عالم أحياء حسابي للمساهمة في تطوير خطوط أنابيب تحليل جديدة لمجموعات البيانات الجينومية واسعة النطاق ، لتطبيق خطوط الأنابيب هذه على مجموعات البيانات الجينومية البشرية الكبيرة بشكل متزايد ، والعمل عن كثب مع موظفي المركز الآخرين والباحثين الخارجيين لتنفيذ ونشر تحليلات جديدة للبيانات. سينضم عالم الأحياء الحاسوبية إلى فريق تعاوني للغاية بما في ذلك فريق التحليل وتطوير الأساليب الآخرين ، ومهندسي البرمجيات ، ومديري المشاريع ، والمتخصصين في المجتمعات ، والمتدربين.

كجزء من مهمة مركز علم الجينوم السكاني ، سيكون هذا الفريق مسؤولاً عن معالجة البيانات التي تم إنشاؤها من خلال مشاريع التسلسل الجديدة بالإضافة إلى تجميع الموارد العامة لإنشاء مورد جديد لعلم الوراثة البشرية يعكس التنوع السكاني الرائع في أستراليا. سيقوم الفريق أيضًا بإدارة مجموعات بيانات الجينوم والإكسوم و RNA-seq وغيرها من مجموعات البيانات الجينومية من مرضى الأمراض النادرة وأفراد أسرهم ، بهدف تحسين تشخيص الأمراض الوراثية الشديدة. سيتم إجراء هذه التحليلات ضمن منصة حسابية سحابية قابلة للتطوير. ستتم مشاركة مجموعات البيانات والبرامج الناتجة على نطاق واسع مع مجتمع البحث الأوسع ، مما يزيد من تأثيرها على النتائج العلمية والصحية.

في حين أن هذا المنصب سيتضمن التعرض المباشر لعلوم الجينوم المتطورة ، فإن مقاييس النجاح والترويج ستكون على تطوير ونشر طرق التحليل المعقدة على نطاق واسع ، وليس على المقاييس الأكاديمية التقليدية مثل المنشورات الرائدة. يتم تمويل هذه الوظائف مركزيًا ولا تعتمد على الزمالات أو غيرها من عمليات جمع الأموال. ستكون هذه الأدوار مناسبة بشكل أفضل للأفراد الذين لديهم سجل حافل من المخرجات العلمية الذين يرغبون في الاستمرار في المساهمة في العلوم المؤثرة ولكن ليس في المسار الوظيفي الأكاديمي التقليدي.

للتكيف مع تأثير COVID-19 ، أطلقنا المركز في إطار نموذج بعيد تمامًا ، وهو مفتوح للمواقع البعيدة على المدى الطويل.

هذه وظيفة بدوام كامل لمدة 3 سنوات ويتراوح راتبها السنوي بين 92،000 دولار - 120،000 ألف دولار أمريكي مع الأخذ في الاعتبار مجموعة المهارات والخبرة ، بالإضافة إلى مزايا التقاعد والراتب وإمكانية التمديد.

سيكون عالم الأحياء الحاسوبية جزءًا من فريق التحليل في المركز ، والذي سيكون مسؤولاً عن تطوير خطوط أنابيب قابلة للتطوير للتحليلات الجينية المعقدة ، للعمل عن كثب مع فريق تطوير البرامج بالمركز لتنفيذ هذه على نطاق الإنتاج عبر البيانات من عشرات الآلاف من الأفراد ، و لأداء مراقبة الجودة والتحليل عبر مجموعات البيانات الناتجة. سيتألف هذا الفريق من أعضاء يتمتعون بمهارات متنوعة عبر البيولوجيا الحسابية وعلم الوراثة الإحصائي وعلم الوراثة السكانية ، ويعملون بشكل تعاوني لإنشاء خطوط الأنابيب هذه وإجراء التحليلات والمساهمة على نطاق واسع في نشر العلوم عالية التأثير.

تشمل المسؤوليات الرئيسية ما يلي:

تطوير مناهج جديدة ، وقياس المقاربات الحالية بدقة ، لتحليل تسلسل الجينوم واسع النطاق ، RNA-seq ، وحيدة الخلية RNA-seq ، وأنواع البيانات الجينومية الأخرى عبر عشرات الآلاف من العينات البشرية

تطوير كود نموذج أولي لمقاربات التحليل ، والعمل عن كثب مع فريق هندسة البرمجيات لضمان نشر هذا الكود على نطاق واسع ومشاركته كبرنامج مفتوح المصدر

إجراء رقابة صارمة على الجودة وتحليل مجموعات البيانات الجينومية الضخمة

الاجتماع بانتظام مع متدربي المركز والموظفين العلميين الآخرين لتحديد التحديات الرئيسية في معالجة البيانات وتحليلها ، والعمل بشكل استباقي مع أعضاء الفريق الآخرين لتحديد الحلول

المساهمة بنشاط في المناقشات العلمية حول أفضل الأساليب لفهم مجموعات البيانات الكبيرة التي تم إنشاؤها ومعالجتها من قبل المركز

المساهمة بنشاط في تطوير البرمجة وتحليل أفضل الممارسات من خلال اجتماعات مراجعة التعليمات البرمجية العادية والأنشطة الأخرى مثل البرمجة الزوجية

تشمل المهارات والخبرات الأساسية ما يلي:

إما ماجستير أو دكتوراه في علم الأحياء الحسابي ، أو علم الجينوم الوظيفي ، أو تعلم الآلة ، أو الإحصاء ، أو مجال ذي صلة ، أو ما يعادله من خبرة العمل المباشرة في هذه المجالات

خبرة كبيرة مع Python و R ، أو ما شابه ذلك

خبرة مثبتة في العمل في بيئات الحوسبة السحابية أو عالية الأداء

أثبتت الخبرة في التحكم في الإصدار ومستودعات البرامج

خبرة مباشرة في إجراء مراقبة الجودة وتحليل مجموعات البيانات الجينومية أو أنواع البيانات المعقدة الأخرى

يتمتعون باستقلالية عالية ولديهم دوافع ذاتية: قادرون على تحديد وإدارة تنفيذ استراتيجيات جديدة للتحليل عبر مجال خبرتهم

مهارات اتصال كتابية جيدة: قادرة على المساهمة بفعالية في الأوراق والتقارير الفنية

شغف حقيقي لتطوير البرمجيات مفتوحة المصدر ، والمساهمة في الكود في النظام البيئي الأوسع لعلم الأحياء الحسابي

تعاوني للغاية: يركز بشكل أكبر على حل المشكلات البيولوجية والطبية المهمة من خلال العمل مع الآخرين بدلاً من تأمين الائتمان الفردي والاستعداد للانخراط مع أعضاء الفريق الآخرين من مجموعة متنوعة من الخلفيات لتنفيذ المهام العلمية المعقدة

عقلية حل المشكلات: قادرة على اجتياز سلسلة معقدة وديناميكية من العقبات التقنية ، والتحول بسرعة عند الحاجة ، لبناء مشروع بحثي فريد من نوعه ، شخص يحدد المشكلات حتى لو كانت تقع خارج نطاق اختصاصه المباشر ، ويعمل مع أعضاء الفريق الآخرين لحلها

ستكون الخبرة المباشرة في الحوسبة السحابية ، وتحليل مجموعات البيانات الجينومية الكبيرة جدًا ، مفيدة

ستكون الخبرة المباشرة في تصور البيانات المعقدة أو مناهج التعلم الآلي ميزة إضافية

للتقدم لهذا المنصب ، يرجى تقديم طلبك مع سيرة ذاتية وخطاب تغطية كوثيقة واحدة ، مع ذكر سبب اهتمامك بهذا الدور. نحن نراجع الطلبات فور ورودها. إذا كنت تعتقد أنك الشخص المناسب لهذا الدور ، فنحن نحب أن نسمع كيف تميزك قدراتك وإنجازاتك وخبراتك. فقط المتقدمون الذين لديهم حقوق عمل كاملة في أستراليا مؤهلون للتقدم لهذا الدور.


خلفية

البيئات القاسية ، التي تتميز عمومًا بدرجة حرارة غير طبيعية ، ودرجة الحموضة ، والضغط ، والملوحة ، والسمية ، ومستويات الإشعاع ، يسكنها العديد من الكائنات الحية - المتطرفة - التي تتكيف بشكل خاص مع هذه الظروف الخاصة. أدت الدراسات التي أجريت على هذه الكائنات الدقيقة إلى تطوير تقنيات بيولوجية جزيئية مهمة مثل تفاعل البوليميراز المتسلسل (PCR) [1 ، 2] وبالتالي تم تحفيز المزيد من الأبحاث بشكل كبير من خلال اهتمام الصناعة بحقيقة أن آليات بقاء هذه الكائنات الدقيقة يمكن أن تتحول إلى تطبيقات قيمة تتراوح من معالجة مياه الصرف الصحي إلى تشخيص الأمراض المعدية والوراثية [3].

الكائنات الدقيقة المحبة للملوحة هي الكائنات الحية المتطرفة القادرة على تحمل الأسمولية العالية في ظروف شديدة الملوحة إما عن طريق الحفاظ على الملوحة العالية في السيتوبلازم أو عن طريق التراكم داخل الخلايا لمواد حماية التناضح مثل ectoine و betaine [4]. C. salexigens هي بكتيريا Gammaproteobacterium المحبة للملوحة من الأسرة هالوموناداسي مع التمثيل الغذائي متعدد الاستخدامات الذي يسمح ليس فقط بالنمو السريع لمجموعة كبيرة ومتنوعة من مركبات الكربون البسيطة كمصدر وحيد للكربون والطاقة ولكن أيضًا مقاومة للهيدروكربونات المشبعة والعطرية والمعادن الثقيلة [5 ، 6]. C. salexigens مع القدرة على النمو على مدى واسع من الملوحة [0.5-4 مولار كلوريد الصوديوم] كان أكثر البكتيريا قدرة على الملوحة [7] وفهم آليات تنظيم التناضح في البكتيريا المحبة للملوحة ، فقد تم استخدامه ككائن حي نموذجي [5 ، 7-9]. وعلاوة على ذلك، C. salexigens لديها أيضًا العديد من تطبيقات التكنولوجيا الحيوية الواعدة كمصدر للمواد المذابة المتوافقة والإنزيمات المتوافقة مع الملح والإنزيمات المؤتلفة والمواد الحيوية السطحية والسكريات الخارجية [10].

تسلسل الجينوم من الكائنات الحية المتطرفة ، مثل الأركون الحد من الكبريتات Archaeaglobus fulgidus[11] ، آركون محبة للملح هالوباكتيريوم الأنواع NRC-1 [12] والبكتيريا المحبة للحمض Acidithiobacillus ferrooxidans[13] تم الإبلاغ عنها في وقت سابق. منذ نشر جينوم C. salexigens DSM 3043 [14] زادت المعرفة البيولوجية حول هذه السلالة بشكل كبير وتم تطوير طرق مختلفة تسمح بالتحليل الجيني والتلاعب الجيني [15 ، 16]. من ناحية أخرى ، لم يتم إجراء تحليل منهجي لقدراتها الأيضية والتكنولوجيا الحيوية حتى الآن. هذا ، على مستوى ما ، بسبب عدم وجود ملف في السيليكو نموذج استقلابي شامل يتيح دمج البيانات التجريبية المتعارف عليها بطريقة متماسكة.

إعادة البناء الأيضي هي عملية اتخاذ قرارات غير آلية ومتكررة يتم من خلالها تحديد الجينات والإنزيمات والتفاعلات والمستقلبات التي تشارك في النشاط الأيضي للنظام البيولوجي ، وتصنيفها وربطها ببعضها البعض لتشكيل شبكة [17]. تمت مراجعة عملية إعادة الإعمار من الناحية المفاهيمية في الأدبيات [17-22] ، ومؤخراً ، تم نشر بروتوكول تشغيل معياري يعطي نظرة عامة مفصلة عن البيانات والخطوات الضرورية [23]. حتى الآن ، تم نشر عمليات إعادة البناء الأيضية على نطاق الجينوم لأكثر من 50 كائنًا ، ومن المتوقع أن يزداد هذا العدد بسرعة. لذلك ، تتزايد الحاجة إلى تطوير طرق آلية ، أو على الأقل شبه آلية ، لإعادة بناء شبكات التمثيل الغذائي. يتوفر عدد محدود من أدوات البرمجيات ، مثل أدوات Pathway [24] ، metaSHARK [25] ، Simpheny (Genomatica) ، والتي تهدف إلى مساعدة وتسهيل عملية إعادة الإعمار. ومع ذلك ، فإن المراجعات الحديثة [18 ، 26] تسلط الضوء على المشاكل الحالية مع التعليقات التوضيحية للجينوم وقواعد البيانات ، والتي تجعل إعادة البناء الآلي صعبة وبالتالي تتطلب تقييمًا يدويًا. تم تطبيق عمليات إعادة البناء الأيضية على نطاق الجينوم بنجاح على العديد من الكائنات الحية عبر حقيقيات النوى (على سبيل المثال ، خميرة الخميرة[21 ، 27-29] ، بشري [30] ، نبات الأرابيدوبسيس thaliana[31]) بدائية النواة (على سبيل المثال ، الإشريكية القولونية[32–34], العصوية الرقيقة[35], هيليكوباكتر بيلوري[36, 37], المكورات اللبنية[38], المكورات العنقودية الذهبية[39, 40], المطثية acetobutylicum[41], Pseudomonas putida[42], الزائفة الزنجارية[43], Geobacter metallireducens[44], الوتدية الجلوتاميك[45]) والأثرية (على سبيل المثال ، Methansoarcina barkeri[46], هالوباكتيريوم ساليناروم[47] نوعًا). نظرًا لكونها دليلًا مفيدًا لتحديد الفجوات المعرفية وسدها ، فقد تم استخدام شبكات التمثيل الغذائي هذه نحو محاكاة السلوك الخلوي في ظل ظروف وراثية وفسيولوجية مختلفة ، ووضع سياق للبيانات عالية الإنتاجية ، وتوجيه الاكتشاف القائم على الفرضيات ، واستجواب العلاقات متعددة الأنواع و التحليل الطوبولوجي (انظر [17] لمراجعة شاملة).

هنا ، إعادة بناء مقياس الجينوم لـ C. salexigens تم إنشاء التمثيل الغذائي لـ DSM 3043 بناءً على المعلومات الجينومية والكيميائية الحيوية والفسيولوجية. نظرًا لكونه أول نموذج استقلابي شامل لبكتيريا محبة للملوحة ، فقد تم تصنيفه على أنه أنا OA584 باتباع اصطلاح التسمية الذي اقترحه [33]. تم التحقق من صحة الإمكانات التنبؤية للنموذج ليس فقط مقابل بيانات الأدبيات على في الجسم الحي C. salexigens السمات المظهرية ، نقل واستخدام ركائز مختلفة ولكن أيضًا ضد الملاحظات التجريبية على مسارات تخليق الكولين والبيتين والإكتوين التي تعد أجزاء مهمة من آلية التكيف osmoad.


نتائج

استخدمنا نموذج شبكة FOCI لتقدير شبكة تعايش لـ 5،007 إطارات قراءة مفتوحة من الخميرة (ORFs). البيانات الخاصة بهذا التحليل مستمدة من قياسات ميكروأري المتاحة للجمهور للتعبير الجيني في ظل مجموعة متنوعة من الظروف الفسيولوجية. تفترض طريقة FOCI نموذجًا خطيًا للارتباط بين المتغيرات وتحسب علاقات التبعية والاستقلالية لأزواج المتغيرات حتى متغير تكييف من الدرجة الأولى (أي فردي). يتم توفير أوصاف أكثر تفصيلاً للبيانات وخوارزمية تقدير الشبكة في قسم المواد والطرق.

على أساس معدل إيجابي كاذب من الحكمة يبلغ 0.001 (انظر المواد والطرق) ، فإن الشبكة المقدرة لبيانات تعبير الخميرة لها 11،450 حافة. من الممكن أن ينتج عن إجراء تقدير شبكة FOCI رسوم بيانية فرعية منفصلة - أي مجموعات الجينات التي ترتبط ببعضها البعض ولكنها غير مرتبطة بأي جينات أخرى. ومع ذلك ، فإن شبكة تعايش الخميرة التي قدرناها تتضمن مكونًا واحدًا عملاقًا متصلًا (GCC ، أكبر رسم فرعي بحيث يوجد مسار بين كل زوج من القمم) مع 4686 رأسًا و 11416 حافة. يشتمل المكون المتصل الأكبر التالي على أربعة رؤوس فقط ، وبالتالي فإن دول مجلس التعاون الخليجي تمثل العلاقات بين غالبية الجينات في الجينوم. في الشكل 1 ، نعرض تبسيطًا لشبكة FOCI التي تم إنشاؤها من خلال الاحتفاظ بأقوى 4000 حافة. استخدمنا إجراء عتبة الحافة هذا لتوفير تصور ثنائي الأبعاد ومفهوم للرسم البياني ، وجميع النتائج التي تمت مناقشتها أدناه مستمدة من تحليلات دول مجلس التعاون الخليجي بأكملها لشبكة FOCI.

تبسيط شبكة تعايش الخميرة FOCI التي تم إنشاؤها من خلال الاحتفاظ بأقوى 4000 حافة (= 1729 قمة). تمثل الرؤوس الملونة مجموعة فرعية من الرسوم البيانية الفرعية المتميزة محليًا لأحرف شبكة FOCI كما في الجدول 2 ، ويمكن العثور على مزيد من التفاصيل هناك. لا يتم تمثيل بعض الرسوم البيانية الفرعية المميزة محليًا للجدول 2 في هذا الشكل لأنها تتضمن رسومًا بيانية فرعية لا تقع أوزان حوافها في أعلى 4000 حافة.

القيم المتوسطة والوسيطة والشرطية لدرجة الرأس في دول مجلس التعاون الخليجي هي 4.87 و 4 و 2 على التوالي. أي أن كل جين يُظهر علاقات تعبيرية مهمة مع ما يقرب من خمسة جينات أخرى في المتوسط ​​، والشكل الأكثر شيوعًا للعلاقة هو جينين آخرين. معظم الجينات لديها خمسة جيران أو أقل ، ولكن هناك عدد قليل من الجينات (349) مع أكثر من 10 جيران في شبكة FOCI ، الدرجة القصوى في الرسم البياني هي 28 (الشكل 2 أ). وهكذا ، يُظهر ما يقرب من 7٪ من الجينات علاقات تعبير مهمة مع عدد كبير نسبيًا من الجينات الأخرى. لا تتوافق توصيلية شبكة FOCI مع توزيع قانون الطاقة (انظر ملف البيانات الإضافي 1 للحصول على مخطط تسجيل الدخول لهذا التوزيع). قدّرنا توزيع مسافات المسار بين أزواج الجينات (المُعرَّفة على أنها أصغر عدد من حواف الرسم البياني التي تفصل بين الزوجين) باختيار 1000 رأس مصدر عشوائيًا في دول مجلس التعاون الخليجي ، وحساب مسافة المسار من كل رأس مصدر إلى كل جين آخر في الشبكة (الشكل 2 ب). متوسط ​​مسافة المسير هو 6.46 خطوة ، والوسيط 6.0 (الوضع = 7). أقصى مسافة للمسار هي 16 خطوة. لذلك ، في دول مجلس التعاون الخليجي لشبكة FOCI ، عادة ما يتم فصل أزواج عشوائية من الجينات بستة أو سبعة حواف.

الخصائص الطوبولوجية لشبكة تعايش الخميرة FOCI. توزيع لل (أ) درجات الرأس و (ب) أطوال المسار للشبكة.

تماسك شبكة FOCI مع مسارات التمثيل الغذائي المعروفة

لتقييم الأهمية البيولوجية لشبكة التعايش المقدرة لدينا ، قمنا بمقارنة تكوين 38 مسارًا معروفًا لعملية التمثيل الغذائي (الجدول 1) بشبكة FOCI الخاصة بتكوين الخميرة. في شبكة إعلامية بيولوجية ، يجب تمثيل الجينات المشاركة في نفس المسار (المسارات) كأجزاء متماسكة من الرسم البياني الأكبر. وهذا يعني ، في ظل افتراض أن تفاعلات المسار تتطلب تنظيمًا مشتركًا وتعاونيًا ، يجب أن تكون الجينات في مسار معين قريبة نسبيًا من بعضها البعض في الشبكة العالمية المقدرة.

استخدمنا نهج استعلام المسار لفحص 38 مسارًا استقلابيًا متعلقًا بشبكة FOCI الخاصة بنا. لكل مسار ، قمنا بحساب كمية تسمى "قيمة التماسك" التي تقيس مدى جودة استرداد المسار في نموذج شبكة معين (انظر المواد والطرق). من بين 38 مسارًا تم اختبارها ، 19 لها قيم تماسك مهمة عند مقارنتها بتوزيع المسارات العشوائية من نفس الحجم (ص & lt 0.05 انظر المواد والأساليب). يتم تمثيل معظم مسارات استقلاب الكربوهيدرات والأحماض الأمينية التي فحصناها بشكل متماسك في شبكة FOCI. من بين كل فئة من الفئات الرئيسية لمسارات التمثيل الغذائي المدرجة في الجدول 1 ، لا يتم تمثيل استقلاب الشحوم فقط واستقلاب العوامل المساعدة والفيتامينات بشكل جيد في شبكة FOCI.

أكبر خمسة مسارات متماسكة هي تحلل السكر / استحداث السكر ، ودورة TCA ، والفسفرة التأكسدية ، واستقلاب البيورين ، وتخليق النيكليكانات. تشمل المسارات الأخرى المميزة في تحليلنا دورة الجليوكسيلات (6 من 12 جينًا في أكبر شبكة فرعية متماسكة) ، والتخليق الحيوي للفالين ، والليوسين ، والإيزولوسين (10 من 15 جينًا) ، واستقلاب الميثيونين (6 من 13 جينًا) ، وفينيل ألانين ، والتيروزين ، واستقلاب التربتوفان (شبكتان فرعيتان لكل منهما 6 جينات).تم توضيح العديد من المجموعات الفرعية المتماسكة لشبكة FOCI الناتجة عن استعلامات المسار هذه في ملف البيانات الإضافية 1.

الجمع بين تحليل التمثيل الغذائي للكربوهيدرات الأساسية

بالإضافة إلى التوافق مع المسارات الفردية ، يجب أن يلتقط نموذج الشبكة المفيد التفاعلات بين المسارات. لاستكشاف هذه المشكلة ، استفسرنا عن شبكة FOCI على مسارات مشتركة وقمنا مرة أخرى بقياس تماسكها. نوضح أحد هذه الاستعلامات المجمعة بناءً على أربعة مسارات ذات صلة تشارك في استقلاب الكربوهيدرات: تحلل السكر / استحداث السكر ، استقلاب البيروفات ، دورة TCA ودورة الجليوكسيلات.

يوضح الشكل 3 أكبر رسم بياني فرعي تم استخراجه في هذا التحليل المركب. ينتج عن الاستعلام المدمج مجموعة فرعية من شبكة FOCI أكبر من مجموع الرسوم البيانية الفرعية المقدرة بشكل منفصل عن المسارات الفردية لأنه يسمح أيضًا للجينات غير المرتبطة بالاستعلام والتي ترتبط بمسارات متعددة. تم تلوين عقد الرسم البياني وفقًا لعضويتها في كل من المسارات الأربعة كما حددتها موسوعة كيوتو للجينات والجينوم (KEGG). يتم تعيين العديد من منتجات الجينات إلى مسارات متعددة. هذا واضح بشكل خاص فيما يتعلق بدورة الجليوكسيلات ، الجينات الوحيدة المخصصة بشكل فريد لهذا المسار هي ICL1 (ترميز لياز ستراتي) و ICL2 (2-ميثيل أيزوسيترات لياز).

أكبر رسم فرعي متصل ناتج عن الاستعلام المشترك على أربعة مسارات تشارك في استقلاب الكربوهيدرات: تحلل السكر / استحداث السكر (أحمر) استقلاب البيروفات (أصفر) دورة TCA (أخضر) ودورة غليوكسيلات (وردي). يتم تمييز الجينات التي ترميز البروتينات المشاركة في أكثر من مسار بألوان متعددة. تمثل الرؤوس غير الملونة جينات غير مسار تم استعادتها في استعلام المسار المشترك. أنظر للنص لمزيد من التفاصيل.

في استعلام المسار المشترك هذا ، يتم تمثيل دورة TCA ، وتحلل السكر / استحداث السكر ، ودورة glyxoylate بشكل أساسي من خلال رسم بياني فرعي واحد من خطوتين (انظر المواد والطرق). من ناحية أخرى ، يتم تمثيل استقلاب البيروفات من خلال رسمين فرعيين على الأقل ، أحدهما يتضمن <PCK1, DAL7, MDH2, MLS1, ACS1, ACH1, LPD1, MDH1> والآخر بما في ذلك <GLO1, GLO2, DLD1, CYB2>. تقوم هذه المجموعة الثانية من الجينات بترميز الإنزيمات التي تشارك في فرع من مسار استقلاب البيروفات الذي يؤدي إلى تحلل ميثيل جليوكسال (ميثيل جليوكسال ← L-lactaldehyde → L-lactate → البيروفات والميثيل جليوكسال → (ص)-س-لاكتويل-جلوتاثيون → D-lactaldehyde → D-lactate → بيروفات) [12 ، 13]. في فرع استقلاب الميثيل جليوكسال الذي ينطوي س-لاكتويل-جلوتاثيون ، ميثيجليوكسال يتكثف مع الجلوتاثيون [12]. ومن المثير للاهتمام ، أن اثنين من الجينات المتجاورة غير المرتبطة بالاستعلام ، GRX1 (أحد جيران GLO2) و TTR1 (جار CYB2) ، ترميز البروتينات مع نشاط الجلوتاثيون ترانسفيراز.

موقف من FBP1 في الاستعلام المدمج مثير للاهتمام أيضًا. نتاج FBP1 هو الفركتوز -1،6-بيسفوسفاتيز ، وهو إنزيم يحفز تحويل بيتا-د-فركتوز 1.6-بيسفوسفات إلى بيتا-د-فركتوز 6-فوسفات ، وهو تفاعل مرتبط بتحلل السكر. ومع ذلك ، في شبكتنا ، يرتبط ارتباطًا وثيقًا بالجينات المخصصة لاستقلاب البيروفات ودورة الجليوكسيلات. جيران FBP1 في هذا الاستعلام تشمل ICL1, MLS1, SFC1, PCK1 و IDP3. فيما عدا IDP3، المروجين لكل هذه الجينات (بما في ذلك FBP1) يحتوي على تسلسل تنشيط واحد على الأقل يمكن تصنيفه كعنصر استجابة مصدر الكربون (CSRE) ، والذي يستجيب لمنشط النسخ Cat8p [14]. يتم التعبير عن هذه المجموعة من الجينات في ظل ظروف نمو غير تخمرية في غياب الجلوكوز ، وهي ظروف مميزة للتحول الثنائي [15]. النظر في الجينات الأخرى في المنطقة المجاورة FBP1 في استعلام المسار المجمع نجد ذلك ACS1, IDP2, SIP4, MDH2, ACH1 و YJL045w تم إثبات أنها تحتوي إما على تسلسلات تنشيط شبيهة بـ CSRE و / أو أنها تعتمد جزئيًا على Cat8p [14]. يستمر الارتباط بين هذه الجينات المنشطة Cat8p عندما نقدر شبكة FOCI دون تضمين بيانات DeRisi وآخرون. [15] ، مما يشير إلى أن هذه المجموعة من التفاعلات ليست مجرد نتيجة لإدراج البيانات التي تم جمعها من الثقافات التي تمر بتحول ثنائي.

يتوافق إدراج عدد من الجينات الأخرى في الشبكة الفرعية لاستقلاب الكربوهيدرات مع الأدلة المستقلة من الأدبيات. على سبيل المثال ، ماكامون وآخرون. [16] المحددة YER053c من بين مجموعة الجينات التي تغيرت مستويات التعبير عنها في طفرات دورة TCA.

على الرغم من أن العديد من الارتباطات بين مجموعات الجينات التي تم الكشف عنها في هذه الرسوم البيانية الفرعية يمكن تفسيرها إما من حيث مسارات الاستعلام المستخدمة في بنائها أو فيما يتعلق بالمسارات ذات الصلة ، فإن عددًا من الارتباطات ليس لها تفسير بيولوجي واضح. على سبيل المثال ، يتكون الذيل الموجود على يسار الرسم البياني في الشكل 3 من LSC1, PTR2, PAD1, OPT2, ARO10 و PSP1 ليس له علاقة معروفة واضحة.

الرسوم البيانية الفرعية المميزة محليًا

يوفر تحليل المسارات الأيضية الموصوفة أعلاه اختبارًا لمدى تمثيل المسارات المعروفة في الرسم البياني FOCI. أي أننا افترضنا بعض المعرفة المسبقة حول بنية شبكة مجموعات فرعية من الجينات وسألنا عما إذا كانت شبكتنا المقدرة متماسكة في مقابل هذه المعرفة المسبقة. على العكس من ذلك ، قد يرغب المرء في العثور على رسوم بيانية فرعية مثيرة للاهتمام ومتميزة داخل شبكة FOCI دون إدخال أي معرفة مسبقة والسؤال عما إذا كانت هذه الرسوم البيانية الفرعية تتوافق مع عمليات أو وظائف بيولوجية معينة. لمعالجة هذه المشكلة الثانية ، قمنا بتطوير خوارزمية لحساب "الرسوم البيانية الفرعية المتميزة محليًا" لشبكة تعايش الخميرة FOCI كما هو مفصل في قسم المواد والأساليب. باختصار ، هذه خوارزمية بحث غير خاضعة للرقابة تحدد "الاهتمام" من حيث طوبولوجيا الحافة المحلية وتوزيع أوزان الحواف المحلية على الرسم البياني. الهدف من هذه الخوارزمية هو العثور على الرسوم البيانية الفرعية المتصلة التي يختلف توزيع وزن الحافة عن توزيع الحواف التي تحيط بالرسم الفرعي ، وبالتالي ، يمكن اعتبار هذه الرسوم البيانية الفرعية المتميزة محليًا على أنها تلك الرؤوس والحواف المرتبطة التي `` تبرز '' من الخلفية من الرسم البياني الأكبر ككل.

لقد قيدنا حجم الرسوم البيانية الفرعية ليكون بين سبعة و 150 جينًا ، واستخدمنا معاملات الارتباط الهامشية التربيعية كدالة ترجيح على حواف الرسم البياني FOCI. وجدنا 32 رسمًا بيانيًا فرعيًا متميزًا محليًا ، تحتوي على إجمالي 830 جينًا (الجدول 2). أربعة وعشرون من أصل 32 رسمًا فرعيًا لها مصطلحات توضيحية متسقة في علم الوجود الجيني (GO) [17] مع ص- قيم أقل من 10 -5 (انظر المواد والطرق). يشير هذا إلى أن معظم الرسوم البيانية الفرعية المتميزة محليًا غنية للغاية فيما يتعلق بالجينات المشاركة في عمليات أو وظائف بيولوجية معينة. يتم تمييز أعضاء أكبر 21 رسمًا فرعيًا محليًا في الشكل 1. وترد القائمة الكاملة للرسم البياني الفرعي والجينات المخصصة لهم في ملف بيانات إضافي 2.

تحتوي أكبر خمسة رسوم فرعية متميزة محليًا على شروح GO الأولية التالية: التخليق الحيوي للبروتين (الرسمان الفرعيان A و B) والتكوين الحيوي للريبوسوم والتجميع (الرسم البياني الفرعي C) استجابة للإجهاد واستقلاب الكربوهيدرات (الرسم البياني الفرعي K) والتلوث (الرسم البياني الفرعي N). تُظهر العديد من هذه الرسوم البيانية الفرعية خصوصية عالية جدًا للجينات ذات تعليقات GO التوضيحية الخاصة. على سبيل المثال ، في الرسوم البيانية الفرعية A و B ، يتم تعيين ما يقرب من 97٪ (32 من 33) و 95.5٪ (64 من 67) من الجينات على مصطلح GO "التخليق الحيوي للبروتين".

يعد الرسم البياني الفرعي P أيضًا كبيرًا نسبيًا ويحتوي على العديد من الجينات ذات الأدوار في تكرار وإصلاح الحمض النووي. وبالمثل ، فإن 21 من 34 جينًا مشروحًا في Subgraph F لها دور في تقويض البروتين. ترتبط ثلاثة رسوم بيانية فرعية متوسطة الحجم (S ، T ، U) ارتباطًا وثيقًا بدورة الخلية الانقسامية والتحرك الخلوي. ومن الأمثلة الأخرى على الرسوم البيانية الفرعية ذات الأدوار البيولوجية الواضحة جدًا الرسم البياني الفرعي R (هيستونات) والرسم البياني الفرعي Z (الجينات المشاركة في الاقتران والتكاثر الجنسي). يحتوي الرسم البياني الفرعي X على جينات لها دور في استقلاب الميثيونين أو النقل.

يمكن أن تتحلل بعض الرسوم البيانية الفرعية المتميزة محليًا. على سبيل المثال ، يحتوي الرسم البياني الفرعي K على مجموعتين فرعيتين على الأقل. يتكون أحدها بشكل أساسي من جينات ترميز البروتينات المرافقة: STI1, SIS1, HSC82, HSP82, AHA1, SSA1, SSA2, SSA4, KAR2, YPR158w, YLR247c. تحتوي المجموعة الأخرى على جينات تشارك بشكل أساسي في استقلاب الكربوهيدرات. ترتبط هاتان المجموعتان الفرعيتان ببعضهما البعض حصريًا من خلال HSP42 و HSP104.

تتكون ثلاثة من الرسوم البيانية الفرعية المتميزة محليًا - Q و W و CC - بشكل أساسي من الجينات التي لا توجد لها تعليقات توضيحية للعملية البيولوجية GO. ومن المثير للاهتمام أن غالبية الجينات المخصصة لهذه المجموعات الثلاث توجد في المناطق الفرعية التيلوميرية. هذه الرسوم البيانية الفرعية الثلاثة ليست متصلة بشكل مباشر في الرسم البياني FOCI ، لذلك من غير المحتمل أن يكون تنظيمها مجرد مثال على تنظيم إسكات التيلومير الفرعي [18]. يتضمن الرسم البياني الفرعي Q 26 جينًا ، خمسة منها (YRF1-2, YRF1-3, YRF1-4, YRF1-5, YRF1-6) تتوافق مع نسخ ترميز ORFs من بروتين Y'-helicase 1 [19]. ثمانية جينات إضافية (YBL113c, YEL077c, YHL050c, YIL177c, YJL225c, YLL066c, YLL067c, YPR204w) المخصصة لهذا الرسم البياني الفرعي أيضًا ترميز الهليكازات. يرتبط هذا الرسم البياني الفرعي هيليكس ارتباطًا وثيقًا بالرسم البياني الفرعي P ، والذي يحتوي على العديد من الجينات المشاركة في تكرار الحمض النووي وإصلاحه (انظر الشكل 1). يحتوي الرسم البياني الفرعي W على 10 جينات ، واحد منها فقط تم تعيينه لعملية GO أو وظيفة أو مصطلح مكون. ومع ذلك ، فإن تسعة من الجينات العشرة في الرسم البياني الفرعي (PAU1, PAU2, PAU4, PAU5, PAU6, YGR294w, YLR046c, YIR041w, YLL064c) أعضاء في عائلة جينات seripauperin [20] ، والتي توجد بشكل أساسي تحت التيلومير والتي تقوم بتشفير البروتينات المانعة لجدار الخلية ويمكن أن تلعب دورًا في الحفاظ على سلامة جدار الخلية [18]. مثال آخر على الرسم البياني الفرعي المقابل لعائلة متعددة الجينات هو الرسم البياني الفرعي CC ، والذي يتضمن تسعة ORFs فرعيًا ، ستة منها تشفر بروتينات من عائلة COS. ترتبط بروتينات كوس بالغشاء النووي و / أو الشبكة الإندوبلازمية وقد تورطت في استجابة البروتين غير المطوية [21].

كمثال أخير ، نعتبر الرسم البياني الفرعي FF ، والذي يتكون من سبعة ORFs (YAR010c, YBL005w-A, YJR026w, YJR028w, YML040w, YMR046c, YMR051c) وكلها أجزاء من Ty العناصر ، ترميز المكونات الهيكلية لآلة retrotransposon [22 ، 23]. توضح هذه المجموعة من الجينات بشكل جيد حقيقة أن تحديد مجموعات متميزة محليًا يمكن أن يؤدي إلى اكتشاف العديد من التفاعلات المثيرة للاهتمام. لا يوجد سوى ستة حواف بين هذه الجينات السبعة في الرسم البياني التقديري لـ FOCI ، والارتباطات الهامشية بين مقاييس الارتباط لهذه الجينات ضعيفة نسبيًا (يعني ص

0.62). على الرغم من ذلك ، فإن التوزيع المحلي لأوزان الحواف في الرسم البياني FOCI يُبرز هذه المجموعة على أنها رسم بياني فرعي مثير للاهتمام. يمكن أيضًا استخدام الرسوم البيانية الفرعية القوية محليًا مثل هذه كنقطة بداية لمزيد من إجراءات البحث في الرسم البياني. على سبيل المثال ، الاستعلام عن شبكة FOCI للجيران المباشرين للجينات في الرسم البياني الفرعي FF ينتج عنه ثلاثة ORFs إضافية - YBL101w-A, YBR012w-B، و RAD10. على حد سواء YBL101w-A و YBR012w-B هي عناصر Ty ، بينما RAD10 يشفر نوكلياز خارجي مع دور في إعادة التركيب.


مواد الخريجين

برنامج MIT-WHOI المشترك في علم المحيطات

7.410 الإحصاء التطبيقي

متطلب سابق: إذن المعلم
ز (الربيع)
3-0-9 وحدات
يمكن أن تتكرر للحصول على الائتمان.

يوفر مقدمة للإحصاءات التطبيقية الحديثة. تشمل الموضوعات الطرق القائمة على الاحتمالات للتقدير ، وفترات الثقة ، واختبار الفرضيات ، ونمذجة السلاسل الزمنية لنماذج الانحدار غير البارامترية واختيار النموذج. منظمون حول أمثلة مستمدة من الأدبيات الحديثة.

7.411 ندوات في علم المحيطات البيولوجي

متطلب سابق: إذن المعلم
G (الخريف والربيع)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

مواضيع مختارة في علم المحيطات البيولوجي.

7.421 مشاكل في علم المحيطات البيولوجي

متطلب سابق: إذن المعلم
G (الخريف والربيع)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

مشاكل متقدمة في علم المحيطات البيولوجي مع قراءة واستشارة معينة.

المعلومات: M. Neubert (WHOI)

7.430 موضوعات في علوم البحار الكمية

متطلب سابق: إذن المعلم
G (الخريف والربيع)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول البيئة البحرية الكمية. موضوعات تختلف من عام الى عام.

7.431 موضوعات في علم البيئة البحرية

متطلب سابق: إذن المعلم
G (الخريف)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول المبادئ والعمليات البيئية في التجمعات والمجتمعات البحرية والنظم البيئية. موضوعات تختلف من عام الى عام.

7.432 مواضيع في الفسيولوجيا البحرية والكيمياء الحيوية

متطلب سابق: إذن المعلم
ز (الربيع)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول العمليات الفسيولوجية والكيميائية الحيوية في الكائنات البحرية. موضوعات تختلف من عام الى عام.

7.433 مواضيع في علم المحيطات البيولوجي

متطلب سابق: إذن المعلم
G (الخريف والربيع)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول علم المحيطات البيولوجي. موضوعات تختلف من عام الى عام.

7.434 موضوعات في بيولوجيا العوالق الحيوانية

متطلب سابق: إذن المعلم
G (الخريف والربيع)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول بيولوجيا العوالق الحيوانية البحرية. موضوعات تختلف من عام الى عام.

7.435 موضوعات في علم الأحياء القاعية

متطلب سابق: إذن المعلم
G (الخريف والربيع)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول بيولوجيا الأحياء البحرية. موضوعات تختلف من عام الى عام.

7.436 موضوعات في بيولوجيا العوالق النباتية

متطلب سابق: إذن المعلم
G (الخريف والربيع)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول بيولوجيا العوالق النباتية البحرية. موضوعات تختلف من عام الى عام.

7.437 موضوعات في علم المحيطات البيولوجية الجزيئية

متطلب سابق: إذن المعلم
G (الخريف والربيع)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول علم المحيطات الجزيئي البيولوجي. موضوعات تختلف من عام الى عام.

7.438 موضوعات في سلوك الحيوانات البحرية

متطلب سابق: إذن المعلم
G (الخريف والربيع)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول البيولوجيا السلوكية للحيوانات البحرية. موضوعات تختلف من عام الى عام.

7.439 مواضيع في علم الأحياء الدقيقة البحرية

متطلب سابق: إذن المعلم
G (الخريف)
2-0-4 وحدات
يمكن أن تتكرر للحصول على الائتمان.

محاضرات ومناقشات حول بيولوجيا بدائيات النوى البحرية. موضوعات تختلف من عام الى عام.

7.440 مقدمة في علم البيئة الرياضي

متطلب سابق: حساب التفاضل والتكامل الأول (GIR) ، 1.018 [J] ، أو إذن من المعلم
سنة أكاد 2020-2021: غير معروض
أكاد عام 2021-2022: جي (ربيع)
3-0-9 وحدات

يغطي النماذج الأساسية للنمو السكاني ، والديموغرافيا ، والتفاعل السكاني (المنافسة ، والافتراس ، والتكافل) ، وشبكات الغذاء ، والحصاد ، والأمراض المعدية ، والأدوات الرياضية اللازمة لتحليلها. نظرًا لأن هذه الأدوات أساسية أيضًا لتحليل النماذج في الكيمياء الحيوية وعلم وظائف الأعضاء والسلوك ، فإن الموضوع أيضًا وثيق الصلة على نطاق واسع بالطلاب الذين لا تقتصر اهتماماتهم على المشكلات البيئية.

7.470 علم المحيطات البيولوجي

متطلب سابق: إذن المعلم
ز (الربيع)
3-0-9 وحدات

مخصص للطلاب ذوي التدريب المتقدم في علم الأحياء. نظرة عامة مكثفة على علم المحيطات البيولوجي. تمت مناقشة النماذج الرئيسية ، واعتماد العمليات البيولوجية في المحيط على الجوانب الفيزيائية والكيميائية للبيئة التي تم فحصها. مسح تنوع الموائل البحرية ، والمجموعات الرئيسية من الأصناف التي تعيش في تلك الموائل ، والبيولوجيا العامة لمختلف الأصناف: إنتاج واستهلاك المواد العضوية في المحيط ، فضلاً عن العوامل التي تتحكم في هذه العمليات. تنوع الأنواع ، وهيكل شبكات الغذاء البحرية ، وتدفق الطاقة داخل الموائل البحرية المختلفة مفصلة ومتناقضة.

7.491 البحث في علم المحيطات البيولوجي

متطلب سابق: إذن المعلم
G (الخريف والربيع والصيف)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

بحث موجه في علم المحيطات البيولوجي لا يؤدي إلى أطروحة التخرج ويبدأ قبل الامتحان المؤهل.

علم الأحياء الدقيقة (مايكرو)

7.492 [J] طرق ومشكلات في علم الأحياء الدقيقة

نفس الموضوع مثل 1.86 [J] ، 20.445 [J]
متطلب سابق: لا شيء
G (الخريف)
3-0-9 وحدات

سيقوم الطلاب بقراءة ومناقشة الأدبيات الأولية التي تغطي المجالات الرئيسية للبحث الميكروبي مع التركيز على الأساليب والأساليب المستخدمة لفهم الميكروبات والتعامل معها. تفضيل طلاب السنة الأولى في علم الأحياء الدقيقة وعلم الأحياء.

7.493 [J] علم الوراثة الميكروبية وتطورها

نفس الموضوع مثل 1.87 [J] ، 12.493 [J] ، 20.446 [J]
متطلب سابق: 7.03 ، 7.05 ، أو إذن المعلم
G (الخريف)
4-0-8 وحدات

يغطي جوانب التحليلات الجينية والجينية الميكروبية ، والعقيدة المركزية ، ونقل الجينات الأفقي ، والتطور.

A. D. Grossman ، O. Cordero

7.494 مشاكل البحث في علم الأحياء الدقيقة

متطلب سابق: إذن المعلم
G (الخريف والربيع والصيف)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

أبحاث موجهة في مجالات علوم وهندسة الميكروبات.

7.498 خبرة في التدريس في علم الأحياء الدقيقة

متطلب سابق: إذن المعلم
G (الخريف والربيع)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

لطلاب الدراسات العليا المؤهلين في برنامج الدراسات العليا لعلم الأحياء الدقيقة المهتمين بالتدريس. التدريس في الفصل أو المختبر تحت إشراف عضو هيئة تدريس.

7.499 دورات بحثية في علم الأحياء الدقيقة

متطلب سابق: لا شيء. Coreq: 7.492 [J] أو 7.493 [J] إذن من المدرب
G (الخريف والربيع)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

يقدم الطلاب لأعضاء هيئة التدريس المشاركين في برنامج الدراسات العليا في علم الأحياء الدقيقة المشترك بين الأقسام من خلال سلسلة من ثلاث دورات معملية ، والتي توفر تعرضًا واسعًا لأبحاث علم الأحياء الدقيقة في معهد ماساتشوستس للتكنولوجيا. يختار الطلاب معملًا لبحث الأطروحة بحلول نهاية عامهم الأول. نظرًا للطبيعة متعددة التخصصات للبرنامج والعديد من البرامج البحثية المتاحة ، قد يتمكن الطلاب من العمل بشكل مشترك مع أكثر من مشرف بحث واحد. يقتصر على الطلاب في برنامج الدراسات العليا لعلم الأحياء الدقيقة.

7.MTHG رسالة التخرج علم الأحياء الدقيقة

متطلب سابق: إذن المعلم
G (الخريف ، الشراء داخل التطبيق ، الربيع ، الصيف)
وحدات مرتبة
يمكن أن تتكرر للحصول على الائتمان.

برنامج بحثي يؤدي إلى كتابة أطروحة دكتوراه. يتم الترتيب من قبل الطالب وعضو هيئة التدريس المناسب في معهد ماساتشوستس للتكنولوجيا.

مادة الاحياء

7.50 المنهج والمنطق في البيولوجيا الجزيئية

متطلب سابق: لا شيء. Coreq: 7.51 و 7.52 أو إذن من المدرب
G (الخريف)
4-0-8 وحدات

المنطق والتصميم التجريبي والأساليب في علم الأحياء ، باستخدام مناقشات الأدبيات الأولية لتمييز مبادئ الاستقصاء البيولوجي في صنع الاكتشافات واختبار الفرضيات. بالتعاون مع أعضاء هيئة التدريس ، يطبق الطلاب أيضًا هذه المبادئ لإنشاء مشروع بحثي محتمل ، يتم تقديمه في شكل كتابي وشفهي. يقتصر على طلاب الدراسات العليا الدورة 7.

I. Cheeseman، M. Hemann، J. Lees، D. Sabatini، F. Solomon، S. Vos

7.51 مبادئ التحليل البيوكيميائي

متطلب سابق: إذن المعلم
G (الخريف)
6-0-6 وحدات

مبادئ الكيمياء الحيوية ، والتأكيد على التركيب ، ودراسات التوازن ، وعلم الحركة ، والمعلوماتية ، ودراسات الجزيء الواحد ، والتصميم التجريبي. تشمل الموضوعات الارتباط الجزيئي الكبير والخصوصية ، وطي البروتين وتكشفه ، والأنظمة الخيفية ، وعوامل النسخ ، والكينازات ، والقنوات الغشائية والناقلات ، والآلات الجزيئية.

7.52 علم الوراثة لطلاب الدراسات العليا

متطلب سابق: إذن المعلم
G (الخريف)
4-0-8 وحدات

مبادئ ومناهج التحليل الجيني ، بما في ذلك الوراثة المندلية وعلم الوراثة بدائية النواة ، وعلم الوراثة الخميرة ، وعلم الوراثة التنموية ، وعلم الوراثة العصبية ، وعلم الوراثة البشرية.

هورفيتز ، سي كايزر ، إي لاندير

7.540 [J] الحدود في علم الأحياء الكيميائي

نفس الموضوع مثل 5.54 [J] ، 20.554 [J]
متطلب سابق: 5.07 [J] ، 5.13 ، 7.06 ، وإذن المعلم
G (الخريف)
3-0-9 وحدات

انظر الوصف تحت الموضوع 5.54 [J].

كيسلينج ، م. شولدرز

7.546 [J] علوم وأعمال التكنولوجيا الحيوية

نفس الموضوع مثل 15.480 [J] ، 20.586 [J]
متطلب سابق: لا شيء. Coreq: 15.401 إذن من المدرب
ز (الربيع)
3-0-6 وحدات

انظر الوصف تحت الموضوع 15.480 [J].

7.548 [J] التطورات في التصنيع الحيوي

نفس موضوع 10.53 [J]
يلتقي الموضوع بـ 7.458 [J] ، 10.03 [J]
متطلب سابق: لا شيء
G (الربيع النصف الثاني من الفصل الدراسي)
1-0-2 وحدة

ندوة تبحث في كيفية تصنيع المستحضرات الصيدلانية الحيوية ، فئة متزايدة الأهمية من المستحضرات الصيدلانية. تتراوح الموضوعات من العمليات الحيوية الأساسية إلى التقنيات الجديدة إلى اقتصاديات التصنيع الحيوي. يغطي أيضًا تأثير العولمة على مناهج التنظيم والجودة بالإضافة إلى سلامة سلسلة التوريد. الطلاب الذين يأخذون نسخة الدراسات العليا يكملون المهام الإضافية.

جي سي لوف ، إيه سينسكي ، إس سبرينغز

7.549 [J] دراسات الحالة والاستراتيجيات في اكتشاف الأدوية وتطويرها

نفس الموضوع مثل 15.137 [J] ، 20.486 [J] ، HST.916 [J]
متطلب سابق: لا شيء
سنة أكاد 2020-2021: غير معروض
أكاد عام 2021-2022: جي (ربيع)
2-0-4 وحدات

انظر الوصف تحت الموضوع 20.486 [J].

7.55 دراسات حالة في التصميم التجريبي الحديث

متطلب سابق: إذن المعلم
ز (الربيع)
2-0-7 وحدات

يركز على تعزيز قدرة الطلاب على تحليل وتصميم وتقديم التجارب ، مع التركيز على التقنيات الحديثة. تبدأ مناقشات الفصل مع الأوراق التي طورت أو استخدمت مناهج معاصرة (على سبيل المثال ، الفحص المجهري الكمي والطرق الفيزيائية الحيوية والجزيئية) لمعالجة المشكلات المهمة في علم الأحياء. يعد كل طالب هدفًا محددًا واحدًا لاقتراح بحث معياري لمشروع يركز على استراتيجية البحث والتصميم التجريبي والكتابة.

L. Guarente، S. Spranger

7.571 التحليل الكمي للبيانات البيولوجية (جديد)

متطلب سابق: لا شيء
G (الربيع النصف الأول من الفصل الدراسي)
2-0-4 وحدات

تطبيق نظرية الاحتمالات والأساليب الإحصائية لتحليل البيانات البيولوجية. تشمل الموضوعات: الإحصاء الوصفي والاستنتاجي ، ومقدمة لإحصاءات بايز ، وتصميم التجارب الكمية ، وطرق تحليل مجموعات البيانات عالية الأبعاد. يتم التأكيد على & ltem & gtconceptual & lt / em & gt فهم الموضوعات ، ويتم توضيح الطرق باستخدام لغة برمجة Python. على الرغم من تشجيع الفهم الأساسي لبايثون ، لا يلزم وجود خبرة برمجية. من المتوقع أن يستكشف الطلاب الذين يأخذون نسخة الدراسات العليا الموضوع بعمق أكبر.

7.572 القياسات الكمية ونمذجة النظم البيولوجية (جديد)

متطلب سابق: لا شيء
G (الربيع النصف الثاني من الفصل الدراسي)
2-0-4 وحدات

التصميم التجريبي الكمي وتحليل البيانات والنمذجة للأنظمة البيولوجية. تشمل الموضوعات القياس الكمي المطلق / النسبي ، والضوضاء والتكاثر ، والانحدار والارتباط ، ونمذجة النمو السكاني ، والتعبير الجيني ، والديناميات الخلوية ، وتنظيم التغذية الراجعة ، والتذبذب. من المتوقع أن يستكشف الطلاب الذين يأخذون نسخة الدراسات العليا الموضوع بعمق أكبر.

7.573 الإحصاء الحيوي الحديث (جديد)

الموضوع يلتقي 7.093
متطلب سابق: 7.03 و 7.05
G (الربيع النصف الأول من الفصل الدراسي)
2-0-4 وحدات

يوفر مقدمة عن الاحتمالات والإحصاءات المستخدمة في علم الأحياء الحديث. التوزيعات الاحتمالية المنفصلة والمستمرة ، والنمذجة الإحصائية ، واختبار الفرضيات ، وإحصاءات بايزي ، والاستقلالية ، والاحتمال الشرطي ، وسلاسل ماركوف ، وطرق تصور البيانات ، والتجميع ، وتحليل المكونات الرئيسية ، والطرق غير المعلمية ، ومحاكاة مونت كارلو ، ومعدل الاكتشاف الخاطئ. تطبيقات على الجينوميات الجينية لتحليل تسلسل البروتين والحمض النووي الريبي والحمض النووي. يتضمن الواجب المنزلي لغة برمجة R ، لكن خبرة البرمجة السابقة غير مطلوبة. يكمل الطلاب المسجلين في إصدار الدراسات العليا مشروعًا إضافيًا ، حيث يطبقون طرق الإحصاء الحيوي على البيانات من أبحاثهم.

7.574 علم الأحياء الحسابي الحديث (جديد)

الموضوع يلتقي 7.094
متطلب سابق: 7.03 و 7.05
G (الربيع النصف الثاني من الفصل الدراسي)
2-0-4 وحدات

يقدم طرقًا حديثة في علم الأحياء الحسابي ، مع التركيز على تحليل تسلسل البروتين / الحمض النووي الريبي / الحمض النووي. تشمل الموضوعات تسلسل الجيل التالي من الحمض النووي وتحليل بيانات التسلسل ، و RNA-seq (الكتلة والخلية المفردة) ، وتنميط الريبوسوم ، والبروتيوميات. يكمل الطلاب المسجلين في إصدار الخريجين مشروعًا إضافيًا ، حيث يطبقون أساليب المعلومات الحيوية على البيانات من أبحاثهم.

7.58 البيولوجيا الجزيئية

الموضوع يجتمع مع 7.28
متطلب سابق: 7.03 ، 7.05 ، وإذن المعلم
ز (الربيع)
5-0-7 وحدات

تحليل مفصل للآليات الكيميائية الحيوية التي تتحكم في صيانة وتعبير وتطور جينومات بدائية النواة وحقيقية النواة. تشمل الموضوعات التي تم تناولها في المحاضرة وقراءات الأدبيات ذات الصلة: تنظيم الجينات ، وتكرار الحمض النووي ، وإعادة التركيب الجيني ، وترجمة الرنا المرسال. التأكيد على منطق التصميم التجريبي وتحليل البيانات. تشمل العروض كلاً من المحاضرات والمناقشات الجماعية للأوراق التمثيلية من الأدب. من المتوقع أن يستكشف الطلاب الذين يأخذون نسخة الدراسات العليا الموضوع بعمق أكبر.

7.59 [J] تدريس العلوم والهندسة على مستوى الكلية

نفس الموضوع مثل 1.95 [J] ، 5.95 [J] ، 8.395 [J] ، 18.094 [J]
الموضوع يجتمع مع 2.978
متطلب سابق: لا شيء
سنة أكاد 2020-2021: غير معروض
أكاد عام 2021-2022: جي (خريف)
2-0-2 وحدة

انظر الوصف تحت الموضوع 5.95 [J].

7.60 بيولوجيا الخلية: هيكل ووظائف النواة

متطلب سابق: 7.06 أو إذن من المعلم
ز (الربيع)
3-0-9 وحدات

بنية الجينوم حقيقية النواة ووظيفتها والتعبير عنها ومعالجة الحمض النووي الريبي وتنظيم دورة الخلية. التأكيد على التقنيات والمنطق المستخدم في معالجة المشاكل المهمة في بيولوجيا الخلية النووية. محاضرات حول مجالات موضوعية واسعة في بيولوجيا الخلايا النووية ومناقشات حول الأوراق التمثيلية الحديثة.

7.61 [J] بيولوجيا الخلايا حقيقية النواة: المبادئ والممارسات

نفس الموضوع مثل 20.561 [J]
متطلب سابق: إذن المعلم
G (الخريف)
4-0-8 وحدات

يؤكد على الأساليب والمنطق المستخدم لتحليل بنية ووظيفة الخلايا حقيقية النواة في أنظمة متنوعة (على سبيل المثال ، الخميرة ، الذباب ، الدودة ، الفأر ، التطور البشري ، الخلايا الجذعية ، الخلايا العصبية). يجمع بين المحاضرات ومناقشات المائدة المستديرة المتعمقة لقراءات الأدب بمشاركة نشطة من خبراء هيئة التدريس. يركز على الأغشية (الهيكل والوظيفة وحركة المرور) والعضيات وسطح الخلية ونقل الإشارة والهيكل الخلوي وحركة الخلية والمصفوفة خارج الخلية. تتراوح من الدراسات الأساسية إلى التطبيقات على الأمراض البشرية ، مع التأكيد على التحليل النقدي للنهج التجريبية. التسجيل محدود.

7.62 علم وظائف الأعضاء الميكروبي

الموضوع يجتمع مع 7.21
متطلب سابق: 7.03 ، 7.05 ، وإذن المعلم
G (الخريف)
4-0-8 وحدات

الخصائص البيوكيميائية للبكتيريا والكائنات الدقيقة الأخرى التي تمكنها من النمو في ظل مجموعة متنوعة من الظروف. التفاعل بين البكتيريا والعاثيات. التنظيم الجيني والأيضي لعمل الإنزيم وتكوين الإنزيم. هيكل ووظيفة مكونات غلاف الخلية البكتيرية. إفراز البروتين مع التركيز بشكل خاص على أدواره المختلفة في التسبب في المرض. تشمل الموضوعات الإضافية الطاقة الحيوية ، والتعايش ، واستشعار النصاب ، والاستجابات العالمية لتلف الحمض النووي ، والأغشية الحيوية. من المتوقع أن يستكشف الطلاب الذين يأخذون نسخة الدراسات العليا الموضوع بعمق أكبر.

جي سي ووكر ، إيه جيه سينسكي

7.63 [J] علم المناعة

نفس الموضوع مثل 20.630 [J]
يلتقي الموضوع مع 7.23 [J] ، 20.230 [J]
متطلب سابق: 7.06 واذن مدرس
ز (الربيع)
5-0-7 وحدات

مسح شامل للجوانب الجزيئية والوراثية والخلوية لجهاز المناعة. تشمل الموضوعات خلايا المناعة الفطرية والتكيفية وأعضاء الجهاز المناعي لتكوين الدم في الغلوبولين المناعي ، ومستقبلات الخلايا التائية ، ومركب التوافق النسيجي الرئيسي (MHC) ، وتطور الجينات ووظائف الخلايا الليمفاوية B و T ، والاستجابات المناعية للعدوى والأورام ، والمناعة الذاتية ، ونقص المناعة. . اهتمام خاص بتطور ووظيفة الجهاز المناعي ككل ، كما تدرس بالطرق والتقنيات الحديثة. يستكشف الطلاب الذين يأخذون نسخة الدراسات العليا الموضوع بعمق أكبر ، بما في ذلك دراسة الأدبيات الأولية الحديثة.

س. سبرينجر ، م. بيرنبوم

7.64 الآليات الجزيئية وعلم الأمراض وعلاج الاضطرابات العصبية العضلية البشرية

متطلب سابق: إذن المعلم
سنة أكاد 2020-2021: غير معروض
أكاد عام 2021-2022: جي (ربيع)
3-0-9 وحدات

يحقق في الأساس الجزيئي والسريري للجهاز العصبي المركزي والاضطرابات العصبية العضلية مع التركيز بشكل خاص على استراتيجيات التدخل العلاجي. يدرس التحليل المتعمق للميزات السريرية والآليات المرضية والاستجابات للتدخلات العلاجية الحالية. يغطي الأمراض التنكسية العصبية ، مثل مرض هنتنغتون ، ومرض باركنسون ، ومرض الزهايمر ، والتصلب الجانبي الضموري ، والخرف الصدغي الجبهي ، والاضطرابات العصبية العضلية ، مثل ضمور التوتر العضلي ، والحثل العضلي الكتفي ، والحثل العضلي الدوشيني.

7.65 [J] قلب علم الأعصاب الجزيئي والخلوي 1

نفس موضوع 9.015 [J]
متطلب سابق: لا شيء
G (الخريف)
3-0-9 وحدات

انظر الوصف تحت الموضوع 9.015 [J].

7.66 الأساس الجزيئي للأمراض المعدية

الموضوع يجتمع مع 7.26
متطلب سابق: 7.06 واذن مدرس
سنة أكاد 2020-2021: غير معروض
أكاد عام 2021-2022: جي (ربيع)
4-0-8 وحدات

يركز على مبادئ التفاعلات بين المضيف والممرض مع التركيز على الأمراض المعدية للإنسان. يقدم المفاهيم الأساسية للإمراض من خلال دراسة مسببات الأمراض البشرية المختلفة. يشمل التحليل النقدي ومناقشة القراءات المعينة. من المتوقع أن يستكشف الطلاب الذين يأخذون نسخة الدراسات العليا الموضوع بعمق أكبر.

7.68 [J] علم الأعصاب الجزيئي والخلوي الأساسي II

نفس موضوع 9.013 [J]
متطلب سابق: إذن المعلم
ز (الربيع)
3-0-9 وحدات

انظر الوصف تحت الموضوع 9.013 [J].

7.69 [J] علم الأعصاب التنموي

نفس موضوع 9.181 [J]
يلتقي الموضوع بـ 7.49 [J] ، 9.18 [J]
متطلب سابق: 9.011 أو إذن من المدرب
ز (الربيع)
3-0-9 وحدات

انظر الوصف تحت الموضوع 9.181 [J].

7.70 تنظيم التعبير الجيني

متطلب سابق: إذن المعلم
سنة أكاد 2020-2021: غير معروض
أكاد عام 2021-2022: جي (ربيع)
4-0-8 وحدات

ندوة تدرس المبادئ الأساسية للتنظيم البيولوجي للتعبير الجيني. يركز على الأمثلة التي تدعم هذه المبادئ ، وكذلك تلك التي تتحدى بعض الآراء الراسخة. قد تشمل الموضوعات التي يتم تناولها دور عوامل النسخ ، والمعززات ، وتعديلات الحمض النووي ، والحمض النووي الريبي غير المشفر ، وهيكل الكروماتين في تنظيم التعبير الجيني وآليات الوراثة اللاجينية لحالات النسخ. يقتصر على 40.

7.71 تقنية فيزيائية حيوية

الموضوع يجتمع مع 5.78
متطلب سابق: 5.13 ، 5.60 ، (5.07 [J] أو 7.05) ، وإذن من المعلم
ز (الربيع)
5-0-7 وحدات

يعرّف الطلاب على الأساليب الفيزيائية الحيوية الحديثة لدراسة الأنظمة البيولوجية من النطاق الذري إلى المقاييس الجزيئية والخلوية. يتضمن مناقشة متعمقة حول التقنيات التي تغطي نطاق الدقة الكامل ، بما في ذلك علم البلورات بالأشعة السينية ، والإلكترون ، والفحص المجهري الضوئي. يناقش التقنيات الفيزيائية الحيوية الشائعة الأخرى للتوصيف الجزيئي. تغطي المحاضرات المبادئ النظرية الكامنة وراء التقنيات ، ويتم إعطاء الطلاب تمارين معملية عملية باستخدام الأجهزة المتاحة في معهد ماساتشوستس للتكنولوجيا. يجتمع مع 5.78 عند عرضه في نفس الوقت.

7.72 الخلايا الجذعية والتجديد والتنمية

متطلب سابق: إذن المعلم
ز (الربيع)
4-0-8 وحدات

تشمل الموضوعات الخلايا الجذعية المتنوعة ، مثل الخلايا الجذعية للعضلات والأمعاء والجلد والشعر والخلايا الجذعية المكونة للدم ، وكذلك الخلايا الجذعية متعددة القدرات. تتناول الموضوعات قطبية الخلية والمعلومات الموضعية للخلية ونمذجة نمو الأطراف وتجديدها والقلب والجسم بالكامل وتجديد الخلايا الجذعية في استجابات التطور للجروح وتطبيقات الخلايا الجذعية في تطوير العلاجات. مناقشات أوراق استكمال المحاضرات.

7.73 مبادئ البيولوجيا الكيميائية

متطلب سابق: 7.05 واذن مدرس
ز (الربيع)
لم تقدم بانتظام استشر القسم
3-0-9 وحدات

يمتد الفصل في مجالات البيولوجيا والكيمياء والهندسة ، ويتناول مبادئ البيولوجيا الكيميائية وتطبيقها للطرق والكواشف الكيميائية والفيزيائية في دراسة النظم البيولوجية ومعالجتها. تشمل الموضوعات التفاعلات المتعامدة الحيوية وتوصيف البروتين القائم على النشاط ، ومثبطات الجزيئات الصغيرة وعلم الوراثة الكيميائية ، وتحقيقات الفلورسنت للدراسات البيولوجية ، وطفرات الأحماض الأمينية غير الطبيعية. يغطي أيضًا مناهج البيولوجيا الكيميائية لدراسة تفاعلات التعديل الديناميكية اللاحقة للترجمة ، والتخليق الحيوي للمنتج الطبيعي والتخليق الطفري ، وفحص الأدوية عالي الإنتاجية. من المتوقع أن يستكشف الطلاب الذين يأخذون نسخة الدراسات العليا الموضوع بعمق أكبر.

7.74 [J] موضوعات في الفيزياء الحيوية والبيولوجيا الفيزيائية

نفس الموضوع مثل 8.590 [J] ، 20.416 [J]
متطلب سابق: لا شيء
G (الخريف)
لم تقدم بانتظام استشر القسم
2-0-4 وحدات

انظر الوصف تحت الموضوع 20.416 [J].

سيسي ، ن. فخري ، إم جو

7.76 موضوعات في التركيب والوظيفة الجزيئية

متطلب سابق: إذن المعلم
سنة أكاد 2020-2021: غير معروض
أكاد عام 2021-2022: جي (ربيع)
3-0-6 وحدات

تحليل ومناقشة متعمقان للأدب الكلاسيكي والحالي ، مع التركيز على بنية ووظيفة وآليات البروتينات والجزيئات البيولوجية الأخرى.

7.77 الأحماض النووية ، التركيب ، الوظيفة ، التطور وتفاعلها مع البروتينات

متطلب سابق: 7.05 ، 7.51 ، أو إذن مدرس
ز (الربيع)
3-0-9 وحدات

المسوحات الأدبية الأولية ، مع التركيز على المناهج البيوكيميائية والفيزيائية الحيوية والجينية والتوافقية لفهم الأحماض النووية. تشمل الموضوعات الخصائص العامة والوظائف والأشكال الهيكلية للحمض النووي الريبي النووي والحمض النووي الريبي كمحفزات وكمنظمين للتعبير الجيني تحرير الحمض النووي الريبي ومراقبته ، وتفاعل الأحماض النووية مع البروتينات ، مثل بروتينات أصابع الزنك ، والإنزيمات المعدلة ، والأمينوآسيل- التركيبات tRNA والبروتينات الأخرى للآلة متعدية. يتضمن بعض المحاضرات ولكنه في الغالب عبارة عن تحليل ومناقشة للأدب الحالي في سياق العروض التقديمية للطلاب.

D. Bartel، U. RajBhandary

7.80 أساسيات علم الأحياء الكيميائي

يلتقي الموضوع مع 5.08 [J] ، 7.08 [J]
متطلب سابق: 5.13 و (5.07 [J] أو 7.05)
ز (الربيع)
4-0-8 وحدات

يمتد هذا الفصل إلى مجالات علم الأحياء والكيمياء والهندسة ، ويقدم للطلاب مبادئ البيولوجيا الكيميائية وتطبيق الأساليب والكواشف الكيميائية والفيزيائية لدراسة النظم البيولوجية ومعالجتها. تشمل الموضوعات بنية الحمض النووي ، والتعرف عليه ، ومعالجة طي البروتين واستقراره ، والتفاعلات المتعامدة الحيوية للبروتينات ، وعلم الوراثة الكيميائية القائمة على النشاط ، ومثبطات الجزيئات الصغيرة التي تقوم بفحص تحقيقات الفلورسنت للتحليل البيولوجي والتصوير وطفرات الأحماض الأمينية غير الطبيعية. سيناقش الفصل أيضًا منطق تفاعلات التعديل الديناميكية اللاحقة للترجمة مع التركيز على مناهج البيولوجيا الكيميائية لدراسة العمليات المعقدة بما في ذلك الارتباط بالجليكوزيل والفسفرة والزيوت. من المتوقع أن يستكشف الطلاب الذين يأخذون نسخة الدراسات العليا الموضوع بعمق أكبر.

إمبريالي ، إل كيسلينج ، ر. رينز

7.81 [J] بيولوجيا الأنظمة

نفس الموضوع مثل 8.591 [J]
الموضوع يجتمع مع 7.32
متطلب سابق: (18.03 و 18.05) أو إذن مدرس
G (الخريف)
3-0-9 وحدات

انظر الوصف تحت الموضوع 8.591 [J].

7.82 موضوعات تطور الثدييات وعلم الوراثة

متطلب سابق: إذن المعلم
سنة أكاد 2020-2021: غير معروض
أكاد عام 2021-2022: جي (ربيع)
3-0-9 وحدات

ندوة تغطي المناهج الجنينية والجزيئية والجينية لتنمية الفئران والبشر. تشمل الموضوعات تطوير الخلايا الجذعية الجنينية للمعدة قبل الزرع ، واستهداف الجينات وإعادة البرمجة النووية للخلايا الجسدية ، والطبع الجيني للجينوم ، وتحديد جنس تعطيل X ، والخلايا الجرثومية.

7.85 بصمات السرطان

الموضوع يجتمع مع 7.45
متطلب سابق: لا شيء. Coreq: 7.06 إذن من المدرب
G (الخريف)
4-0-8 وحدات

يوفر مقدمة شاملة لأساسيات بيولوجيا السرطان وعلاج السرطان. تشمل الموضوعات علم الوراثة السرطانية وعلم الجينوم وعلم التخلق المتلازمات السرطانية العائلية نقل الإشارات ، والتحكم في دورة الخلية ، والتمثيل الغذائي لسرطان الخلايا الجذعية والورم الخبيث السرطاني والمناعة والعلاج المناعي والعلاجات التقليدية والموجهة جزيئيًا والكشف المبكر والوقاية. الطلاب الذين يأخذون نسخة الدراسات العليا يكملون المهام الإضافية.

تي جاك ، إم فاندر هايدن

7.86 البناء بالخلايا

الموضوع يجتمع مع 7.46
متطلب سابق: 7.03 و 7.05
G (الخريف)
4-0-8 وحدات

يركز على المبادئ الأساسية لعلم الأحياء التطوري الذي من خلاله تبني الخلايا الأعضاء والكائنات الحية. يحلل الدور المحوري للخلايا الجذعية في صيانة الأنسجة أو إصلاحها وفي علاج الأمراض. يستكشف كيفية دمج هذه المعرفة مع الأدوات الهندسية لبناء هياكل الأنسجة الوظيفية. الطلاب الذين يأخذون نسخة الدراسات العليا يكملون المهام الإضافية.

7.89 [J] موضوعات في علم الأحياء الحسابي والأنظمة

نفس موضوع CSB.100 [J]
متطلب سابق: إذن المعلم
G (الخريف)
2-0-10 وحدات

انظر الوصف تحت الموضوع CSB.100 [J]. الأفضلية لطلاب الدكتوراه في CSB في السنة الأولى.

7.930 [J] الخبرة البحثية في الأدوية الحيوية

نفس الموضوع مثل 20.930 [J]
متطلب سابق: لا شيء
ز (الربيع)
2-10-0 وحدة

انظر الوصف تحت الموضوع 20.930 [J].

7.931 دراسة مستقلة في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف والربيع)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

برنامج الدراسة أو البحث الذي سيتم ترتيبه مع عضو هيئة التدريس بالقسم.

7.932 دراسة مستقلة في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف والربيع)
وحدات مرتبة
يمكن أن تتكرر للحصول على الائتمان.

برنامج الدراسة أو البحث الذي سيتم ترتيبه مع عضو هيئة التدريس بالقسم.

7.933 تناوب البحث في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف والربيع)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

يقدم الطلاب لأعضاء هيئة التدريس المشاركين في برنامج الدراسات العليا في علم الأحياء من خلال سلسلة من الدورات المعملية ، والتي توفر تعرضًا واسعًا لأبحاث علم الأحياء في معهد ماساتشوستس للتكنولوجيا. يختار الطلاب معملًا لبحث الأطروحة بحلول نهاية عامهم الأول. يقتصر على الطلاب في برنامج الدراسات العليا في علم الأحياء.

7.934 خبرة في تدريس علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف والربيع)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

لطلاب الدراسات العليا المؤهلين في برنامج الدراسات العليا في علم الأحياء المهتمين بالتدريس. التدريس في الفصل أو المختبر تحت إشراف عضو هيئة تدريس.

7.935 السلوك المسؤول في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف)
الوحدات المرتبة [P / D / F]

تركز الجلسات على السلوك المسؤول للعلم. يعتبر حفظ السجلات والإبلاغ عن أدوار الموجه والمتدرب التأليف ، والمراجعة ، والسرية ، وحل النزاعات ، والتعاون في المخالفات ، والمصالح المتنافسة ، والملكية الفكرية والممارسات السليمة في استخدام الحيوانات والبشر. يقتصر على طلاب الدراسات العليا في السنة الثانية في علم الأحياء.

7.936 التطوير المهني في علم الأحياء

متطلب سابق: لا شيء
G (الخريف والربيع)
0-2-0 وحدة

مطلوب لطلاب الدكتوراه في الدورة السابعة لاكتساب منظور مهني في أنشطة التطوير الوظيفي مثل التدريب الداخلي والاجتماعات العلمية وفعاليات التوظيف والتواصل. تقرير مكتوب مطلوب عند الانتهاء من الأنشطة.

7.941 مشاكل البحث

متطلب سابق: إذن المعلم
G (الخريف ، الصيف)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

بحث موجه في مجال العلوم البيولوجية ، ولكن ليس مساهماً في تخريج أطروحة.

استشر مكتب تعليم الأحياء

7.942 مشاكل البحث

متطلب سابق: إذن المعلم
ز (الربيع)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

بحث موجه في مجال العلوم البيولوجية ، ولكن ليس مساهماً في تخريج أطروحة.

استشر مكتب تعليم الأحياء

7.95 بيولوجيا السرطان

متطلب سابق: 7.85 واذن المعلم
ز (الربيع)
3-0-9 وحدات

ندوة متقدمة تنطوي على تحليل مكثف للتطورات التاريخية والحالية في بيولوجيا السرطان. تتناول الموضوعات مبادئ موت الخلايا المبرمج ، ومبادئ بيولوجيا السرطان ، وعلم الوراثة السرطانية ، واستقلاب الخلايا السرطانية ، ومناعة الورم ، والعلاج. تحليل مفصل للأدبيات البحثية ، بما في ذلك التقارير المهمة المنشورة في السنوات الأخيرة. التسجيل محدود.

7.98 [J] اللدونة العصبية في التعلم والذاكرة

نفس موضوع 9.301 [J]
متطلب سابق: إذن المعلم
ز (الربيع)
3-0-6 وحدات

انظر الوصف تحت الموضوع 9.301 [J]. يحتاج الصغار وكبار السن إلى إذن من المعلم.

7.S930 مادة خاصة في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف والربيع والصيف)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

يغطي المواد في مجالات علم الأحياء المختلفة التي لا تقدمها مواد التدريس العادية.

7.S931 مادة خاصة في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف والربيع والصيف)
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

يغطي المواد في مجالات علم الأحياء المختلفة التي لا تقدمها مواد التدريس العادية.

7.S932 مادة خاصة في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف ، الشراء داخل التطبيق ، الربيع)
لم تقدم بانتظام استشر القسم
الوحدات المرتبة [P / D / F]
يمكن أن تتكرر للحصول على الائتمان.

يغطي المواد في مجالات علم الأحياء المختلفة التي لا تقدمها مواد التدريس العادية.

7.S939 مادة خاصة في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف ، الشراء داخل التطبيق ، الربيع)
لم تقدم بانتظام استشر القسم
وحدات مرتبة
يمكن أن تتكرر للحصول على الائتمان.

يغطي المواد في مجالات علم الأحياء المختلفة التي لا تقدمها مواد التدريس العادية.

7. أطروحة الدراسات العليا في علم الأحياء

متطلب سابق: إذن المعلم
G (الخريف ، الشراء داخل التطبيق ، الربيع ، الصيف)
وحدات مرتبة
يمكن أن تتكرر للحصول على الائتمان.


المواد والأساليب

سلالات، ووسائل الإعلام، وظروف النمو

S. cerevisiae سلالة BY4741 (حصيرة أ, له 3Δ, ليو 2Δ0, ميت 15 - 0, uraΔ0) في وسط صناعي كامل عند 30 درجة مئوية. نمت الخلايا بكثافة 1 × 10 7 خلية لكل مل. تم تقسيم الثقافات إلى اثنين من NaAsO2 تمت إضافة (100 ميكرومتر و 1 ملي مولار في مكررين بيولوجيين) إلى ثقافة واحدة ، وتم تحضينهما عند 30 درجة مئوية لمدة 0.5 أو 2 أو 4 ساعات. تم تكوير الخلايا وغسلها في الماء المقطر قبل استخراج الحمض النووي الريبي. سلالات الحذف (ياب, cad1Δ, arr1Δ و rpn4Δ) من نفس الخلفية من Research Genetics ، تم تأكيدها ومعالجتها بنفس الطريقة ، لمدة ساعتين و 100 ميكرومتر NaAsO2.

استخراج الحمض النووي الريبي

بالنسبة لتجارب تهجين (كدنا) ، تم عزل الحمض النووي الريبي الكلي باستخدام طريقة حمض الفينول. تم تعليق الكريات في محلول تحلل 4 مل (10 ملي مولار Tris-HCL pH 7.5 ، 10 ملي مول EDTA ، 0.5 ٪ SDS). تمت إضافة أربعة مليلتر من الفينول الحمضي (مشبع بالماء ، ودرجة حموضة منخفضة) متبوعًا بالدوامة. تم تحضين محاليل الخلايا المتحللة عند 65 درجة مئوية لمدة ساعة واحدة مع دوامة قوية عرضية ثم وضعها على الجليد لمدة 10 دقائق قبل الطرد المركزي عند 4 درجات مئوية لمدة 10 دقائق. تم إعادة استخلاص الطبقات المائية بالفينول (درجة حرارة الغرفة ، بدون حضانة) واستخلاصها مرة واحدة بالكلوروفورم. تمت إضافة أسيتات الصوديوم بعد ذلك إلى 0.3 م مع 2 مجلدين من الإيثانول المطلق ، توضع عند -20 درجة مئوية لمدة 30 دقيقة ، ثم تُغزل. تم غسل الكريات مرتين أو ثلاث مرات باستخدام 70 ٪ من الإيثانول متبوعًا بتنقية Qiagen Poly (A) + RNA بخطوة اختيار Oligotex oligo (dT). تم عزل إجمالي الحمض النووي الريبي لسلالات خروج المغلوب المحددة والتجربة الأم عن طريق التفاعل الإنزيمي ، باتباع بروتوكول الخميرة RNeasy (Qiagen).

تهجين وتحليلات ميكروأري

تم استخدام شريحة خميرة (كدنا) ، تم تطويرها داخليًا في المعهد الوطني لعلوم الصحة البيئية (NIEHS) ، في تجارب التنميط الجيني للتعبير الجيني. تتوفر قائمة كاملة بـ ORFs على هذه الشريحة في [70]. تم تحضير رقائق ميكروأري (كدنا) كما هو موضح سابقًا [71 ، 72]. تم رصد [كدنا] كما هو موصوف [73]. تم تصنيف كل عينة بولي (A) من الحمض النووي الريبي (2 ميكروغرام) بـ Cy3- أو Cy5- مترافق dUTP (أميرشام) من خلال تفاعل النسخ العكسي باستخدام النسخ العكسي SuperScript (Invitrogen) ، والتمهيدي oligo (dT) (Amersham). تم إجراء التهجين والتحليل على النحو الموصوف لهويت وآخرون. [74] باستثناء أن الجينات التي لها قيم شدة نسبة طبيعية خارج نطاق ثقة 95٪ تم اعتبارها معبرة بشكل تفاضلي بشكل كبير. تم إيداع قوائم الجينات المعبر عنها تفاضليًا في قاعدة بيانات NIEHS MAPS [75]. تم تجميع الجينات التي تم التعبير عنها بشكل تفاضلي في ما لا يقل عن ثلاث من التجارب المكررة الأربعة ثم تم تجميعها باستخدام برنامج Cluster / Treeview [76]. تم استخدام GeneSpring (Silicon Genetics) و Cytoscape [28] لمزيد من تحليل وتصور البيانات.

أجريت التجارب بالضربة القاضية على منصة مصفوفة خميرة أوليجو Agilent. تم تصنيف عينات من 10 ميكروغرام من الحمض النووي الريبي الإجمالي باستخدام بروتوكول مجموعة الملصقات المباشرة الفلورية Agilent وتم إجراء عمليات التهجين لمدة 16 ساعة في فرن تهجين دوار باستخدام بروتوكول Agilent 60-mer oligo microarray. تم غسل الشرائح كما هو محدد وتم مسحها ضوئيًا باستخدام ماسح ضوئي Agilent. تم جمع البيانات باستخدام برنامج استخراج ميزة Agilent ، باستخدام الإعدادات الافتراضية لجميع المعلمات ، وحفظ شروط النسبة. لحساب استخدام بروتوكول التسمية المباشر ، تم تغيير شروط الخطأ إلى: خطأ مضاعف Cy5 = 0.15 خطأ مضاعف Cy3 = 0.25 خطأ إضافي Cy5 = 20 خطأ إضافي Cy3 = 20.

تم تصدير ملفات وصور GEML من برنامج استخراج ميزة Agilent وإيداعها في Rosetta Resolver (الإصدار 3.2 ، الإصدار 3.2.2.0.33) (Rosetta Biosoftware). تم دمج مصفوفتين لكل زوج من العينات ، بما في ذلك انعكاس الفلور ، في تجارب النسبة في Rosetta Resolver. تم إنشاء مخططات الكثافة لكل تجربة نسبة واعتبرت الجينات "جينات توقيع" إذا كان ص- كانت القيمة أقل من 0.001. ص- تم حساب القيم باستخدام نموذج خطأ Rosetta Resolver مع شروط خطأ Agilent. تم تحليل جينات التوقيع باستخدام GeneSpring. تتوفر مجموعة البيانات الداخلية بالكامل والقائمة على Agilent في ملفات البيانات الإضافية.

إثراء علم الوجود

تم تصنيف الجينات في السابق إلى مختلف الأنطولوجيات والمسارات. إذا تم إثراء مسار معين للجينات التي يتم التعبير عنها بشكل كبير استجابة لعملية ما ، فإننا نستنتج أن المسار من المحتمل أن يشارك في هذه العملية. في المجموع ، كان لـ 829 جينًا من أصل 6240 تغييرًا كبيرًا في التعبير في حالة تجريبية واحدة على الأقل. إلى جانب حجم كل فئة وظيفية ، تم حساب مقياس إحصائي لأهمية الإثراء باستخدام اختبار فرط هندسي. تم تحديد مستوى الأهمية لهذا الاختبار باستخدام تصحيح Bonferroni ، حيث تم تعيين قيمة α عند 0.05 وكان عدد الاختبارات التي أجريت لمسار KEGG وعلم الجينات المبسط (العملية البيولوجية) 27 و 11 على التوالي.

عمليات البحث على الشبكة

تم استخدام خوارزمية ActiveModules لتحديد الأحياء في الشبكة التنظيمية المقابلة لمستويات كبيرة من التعبير التفاضلي. في هذا البحث ، إذا كان للبروتين العديد من الجيران ، فمن المحتمل أن يظهر عدد قليل عشوائيًا تغييرات مهمة في التعبير ويمكن تحديدها كشبكة فرعية مهمة. تقييم الحي هو طريقة استخدمناها لتصحيح هذا التحيز. في هذا المخطط ، يجب أن تحتوي الشبكة الفرعية المهمة إما على كل جيران كل بروتين أو لا تحتوي على أي منهم. تمثل الأهمية بعد ذلك مجموعًا على جميع الجيران للبروتين. هذا يمنع الاختيار المتحيز لعدد قليل من البروتينات التي حصلت على أعلى الدرجات من حي كبير في البحث عن شبكات فرعية مهمة. للحصول على وصف متعمق لهذه الخوارزمية ، انظر Ideker وآخرون. [1].

عند تحديد الشبكة المستخدمة في التحليل الأيضي ، تم التخلص من الحواف المقابلة للمستقلبات التي تربط أكثر من 175 تفاعلًا. هذا لا يشمل العوامل المساعدة الأيضية مثل ATP و NADH و H.2يا من البحث. تم إنشاء الدرجات لكل ORF عن طريق تعيين قيمة أهمية اللياقة إلى Z-Score. لتعيين درجات للتفاعلات الفردية ، تم استخدام تعيين Förster من ORF للتفاعل لإنشاء قائمة ORFs لكل تفاعل. ثم تم تجميع درجات Z الخاصة بـ ORFs هذه في درجة واحدة لهذا التفاعل باستخدام المعادلة التالية:

استخدمنا خوارزمية برمجة ديناميكية مقتبسة من Kelley وآخرون. [77] لتحديد المسارات عالية الدرجات في هذه الشبكة. باختصار ، المسار الذي حصل على أعلى الدرجات (ن) تنتهي عند كل عقدة من خلال الجمع بين درجات العقدة الفردية ومسار الطول الأعلى درجة (ن - 1) تنتهي عند عقدة مجاورة باستخدام الصيغة التالية:

نظرًا لأنه من المرجح أن تنتمي العقدة التي بها العديد من الجيران إلى مسار عالي الدرجات عن طريق الصدفة العشوائية ، يتم تصحيح درجة المسار المجاور مقابل إحصائية القيمة القصوى مع عدد الملاحظات الذي يساوي عدد الجيران.

تم تحديد أهمية الشبكات التي حصلت على أعلى الدرجات من خلال المقارنة مع توزيع الشبكات ذات أعلى الدرجات من البيانات العشوائية (درجات التفاعل العشوائية فيما يتعلق بعقد الشبكة). بعد تشغيل خوارزمية إيجاد المسار / تسجيل الدرجات ، تمت إضافة درجة المسار الفردي الأعلى درجة إلى التوزيع الفارغ. تكررت هذه العملية لـ 10000 تفاعل. ثم تم استخدام هذا التوزيع الفارغ لتحديد تجريبي ص-value ، والتي تمثل الفرضية الصفرية القائلة بعدم وجود علاقة ارتباط ذات دلالة إحصائية بين طوبولوجيا الشبكة الأيضية وتعيين قيم الأهمية للعقد في تلك الشبكة.

مرشح تجربة حذف محددة على مقارنات التغيير أضعاف

تم إنشاء مخططات الكثافة من كل تجربة في Rosetta Resolver. يعتبر الجين جين توقيع إذا كان ص- كانت القيمة أقل من 0.001 وإذا كانت قيمة تغيير الطية أكبر من أو تساوي ضعفين. ثم تم بث جينات التوقيع على مخطط الكثافة وتصديرها كملفات نصية. تم استيراد القوائم إلى GeneSpring. تم استخدام وظيفة "التصفية عند تغيير الطية" لمقارنة تجربة التحكم الرئيسي مقابل تجربة AsIII الأصلية مع كل تجربة حذف (AsIII). كانت قائمة الجينات المحددة لكل مرشح في تحليل تغيير الطية عبارة عن مزيج من قائمة جينات التوقيع الأصلي وقائمة جينات التوقيع للحذف المعالج بـ AsIII الذي يتم تحليله في ذلك الوقت. على سبيل المثال ، إذا تم إجراء المقارنة بين الوالد (معالج AsIII) و Yap1 (معالج AsIII) ، فإن القائمة المستخدمة في التحليل كانت عبارة عن مزيج من جينات التوقيع الأصلية وجينات توقيع Yap1. يُبلغ عامل التصفية عند تغيير الطية عن الجينات التي تم اختيارها من الشرط الوحيد (الأصل) الذي كان له قيم بيانات طبيعية أكبر أو أقل من تلك الموجودة في الحالة الأخرى (الحذف قيد التحقيق) بعامل مزدوج. تم حفظ كل قائمة الجينات الناتجة. تم دمج جميع قوائم الجينات الناتجة وتم تصدير قائمة الجينات المشروحة للاستخدام في حزمة Eisen's Cluster / Treeview (الموصوفة سابقًا). كان تنسيق البيانات المصدرة هو السجل الطبيعي. تم إنشاء شجرة الجينات التي تم إنشاؤها للورق في GeneSpring. تم حفظ كل مرشح عند تغيير الطية كقائمة جينات مشروحة.

إنشاء تجربة حذف محددة "ناقص" القوائم

تم إنشاء قوائم جينات التوقيع في Rosetta Resolver من مخططات الكثافة كما هو موضح أعلاه. تم حفظ كل قائمة جينات توقيع كـ "Bioset" في Resolver. تمت مقارنة Bioset الأصلي مع كل Bioset للحذف باستخدام وظيفة "الطرح". تعثر هذه الوظيفة على الأعضاء في مجموعة Bioset 1 (الأصل) غير الموجودين في Bioset group 2 (الحذف). تم حفظ كل من القوائم الناتجة كمجموعة Bioset جديدة. تم بث Bioset الجديد "ناقص" على مخطط الكثافة المقابل له وتصديره كملف نصي. تم تكرار هذا لكل تجربة مع ضبط البيانات باستخدام GeneSpring.

التنميط المظهري

تم عمل سلالات حذف ثنائي الصبغيات متماثلة اللواقح وتجميع السلالات كما هو موصوف [66]. نمت قسامات حتى المرحلة اللوغاريتمية ، مخففة إلى OD600 0.05-0.1 ، مقسمة إلى أنابيب ومعالجتها بالزرنيخ لمدة 1-2 ساعة بتركيزات 1 مم و 2 مم و 5 مم. لوحظت استجابات مماثلة في كل تركيز ، لذلك تم تجميع النتائج. تم الحفاظ على هذه الثقافات وعينة المعالجة الوهمية في نمو الطور اللوغاريتمي عن طريق التخفيف الدوري لمدة 16-18 ساعة. تم تضخيم متواليات UPTAG و DOWNTAG بشكل منفصل من الحمض النووي الجيني للعقار والعينات المعالجة بواسطة PCR باستخدام البادئات التي تحمل علامات البيوتين كما هو موضح سابقًا [66]. تم دمج منتجات التضخيم وتهجينها إلى مصفوفات Tags3 (Affymetrix). تم تنفيذ إجراءات تضخيم تفاعل البوليميراز المتسلسل والتهجين والمسح كما هو موصوف [66] ، ووفقًا لتوصية الشركة الصانعة عند الاقتضاء. تم قياس الصور باستخدام برنامج Affymetrix Microarray Suite. تم تطبيع قيم UPTAG و DOWNTAG بشكل منفصل ، ونسبة (إشارة العينة المعالجة / التحكم) وترشيحها لكثافة فوق الخلفية [78].


اكتشاف وتوصيف الأشكال التنظيمية للبروتين في حقيقيات النوى على نطاق واسع

جلبت القدرة المتزايدة على توليد بيانات بروتينية كمية واسعة النطاق معها التحدي المتمثل في تحليل مثل هذه البيانات لاكتشاف عناصر التسلسل التي تكمن وراء سلوك البروتين على مستوى الأنظمة. نوضح هنا أنه يمكن استرداد أشكال البروتين الخطية القصيرة بكفاءة من مجموعات البيانات على نطاق البروتين مثل التوطين الخلوي الفرعي والوظيفة الجزيئية والعمر النصفي ووفرة البروتين باستخدام نهج المعلومات النظري. باستخدام هذا النهج ، حددنا العديد من أشكال البروتين المعروفة ، مثل مواقع الفسفرة وإشارات التوطين ، واكتشفنا عددًا كبيرًا من العناصر المرشحة. نحن نقدر ذلك

80 ٪ منها تنبؤات جديدة من حيث أنها لا تتطابق مع فكرة معروفة في كل من التسلسل والسياق البيولوجي ، مما يشير إلى أن التنظيم اللاحق للترجمة لسلوك البروتين لا يزال غير مستكشف إلى حد كبير. توفر هذه الأشكال المتنبأ بها ، والتي يُظهر العديد منها ارتباطًا تفضيليًا بمسارات بيولوجية محددة وموضع غير عشوائي في تسلسل البروتين الخطي ، فرضيات مركزة للتحقق التجريبي.

بيان تضارب المصالح

تضارب المصالح: أعلن المؤلفون أنه لا توجد مصالح متنافسة.


مقدمة

في تطور حقيقيات النوى ، تعتبر الأهمية النسبية لنقل الجينات الأفقي (HGT) مقارنةً بمصادر أخرى للحداثة الجينية (مثل تكرار الجينات ، والتعديل ، ونشأة دي نوفو) موضوعًا غير مستقر. هذا على النقيض من البكتيريا والأركيا ، والتي من بينها تم تأسيس HGT كمحرك رئيسي للابتكار الجيني (Ochman et al. 2000 Pál et al. 2005 Treangen and Rocha 2011). على الرغم من أن تأثير HGT على التطور حقيقية النواة لا يزال ضعيفًا ، إلا أن HGT قد تورط في استغلال منافذ جديدة من قبل العديد من المجموعات الميكروبية ، بما في ذلك apicomplexans (Striepen et al. 2004) ، ciliates (Ricard et al. 2006) ، Diplonads (Andersson et al. 2003) ، والفطريات (Slot and Hibbett 2007). وبالتالي ، قد يكون HGT محركًا مهمًا للابتكار الجيني في بعض السلالات حقيقية النواة على الأقل (Keeling and Palmer 2008 Andersson 2009). ومع ذلك ، فإن الدقة الضعيفة في قاعدة شجرة الحياة حقيقية النواة وكذلك ندرة بيانات تسلسل الجيل التالي من حقيقيات النوى الميكروبية تعقد تفسير سلالات الجينات التي توحي بخلاف ذلك بـ HGT (تمت المراجعة في Stiller 2011 انظر ، على سبيل المثال ، Chan et al. 2012 كيرتس وآخرون .2012 ديشامب وموريرا 2012).

على الرغم من استمرار التحديات في قياس وتفسير HGT في حقيقيات النوى ، فإن نقل الجينات أثناء تطور الميتوكوندريا والبلاستيدات (أي التعايش الداخلي) هو آلية راسخة لنقل الجينات ، وهي عملية يشار إليها بنقل الجينات التكافلي الداخلي (EGT). نشأ البلاستيد الأولي للعصيات القديمة (أي الطحالب الحمراء والخضراء والزرقاء ، Adl وآخرون 2005) من خلال ارتباط تعايش داخلي بين البكتيريا الزرقاء ومضيف حقيقيات النوى غير متجانس (Douglas 1998).تحافظ العضية الناتجة عن التمثيل الضوئي ، البلاستيد ، على جينوم منخفض يصل إلى 200 جين ، لكن غالبية الجينات المطلوبة لعملية التمثيل الضوئي قد تم نقلها إلى الجينوم النووي لمضيف الطحالب (Martin and Herrmann 1998). يتم استهداف العديد من هذه الجينات المنقولة مرة أخرى إلى البلاستيد ، ولكن تم اختيار بعضها للعمل في عمليات جديدة وبالتالي زيادة الإمكانات الوراثية للجينوم المضيف (Martin and Herrmann 1998). التعايش الداخلي البلاستيدي الذي يشمل التعايش الداخلي للطحالب حقيقية النواة ، بدلاً من البكتيريا الزرقاء ، والبلاستيدات الموزعة ، والجينات اللازمة للحفاظ عليها ، عبر شجرة الحياة حقيقية النواة (أرشيبالد 2009).

هناك طريقة أخرى محتملة لـ HGT في حقيقيات النوى الميكروبية وهو الحصول على المواد الجينية أثناء ابتلاع الفريسة (Doolittle 1998) ، والتي تدعمها حسابات HGT في السلالات البلعمة مثل ciliates (Ricard et al. 2006) ، euglenids (Maruyama et al. 2011) ) ، والأميبيا (Eichinger et al. 2005). يأتي المزيد من الدعم لنموذج ابتلاع الفريسة من الطحالب (مجموعة غير أحادية النوى من حقيقيات النوى المحتوية على البلاستيد والبلاستيد). على الرغم من أن الكائنات الحية الأولية المحتوية على البلاستيد هي ذاتية التغذية صارمة ، مع استثناءات قليلة ، فإن العديد من الطحالب ذات البلاستيدات المشتقة عن طريق التعايش الداخلي الإضافي (على سبيل المثال ، euglenids و dinoflagellates) هي مزيج من التغذية التي تكمل عملية التمثيل الضوئي باستهلاك جزيئات الطعام (Stoecker 1998). في حالة هذه الطحالب ذات التغذية المختلطة ، تتوقع فرضية ابتلاع الفريسة أن هذه الكائنات الحية ستحصل على جينات مكتسبة من البلاستيد ومن فرائسها (دوليتل 1998).

دينوفلاجيلات هي طلائعيات (أي ، حقيقيات النوى الميكروبية) شائعة في العديد من البيئات المائية وهي كائنات مثالية للتحقيق في تأثير HGT على تطور حقيقيات النوى. العديد من أنواع دينوفلاجيلات هي نباتات مختلطة ، لها القدرة على الحصول على الكربون من عملية التمثيل الضوئي وكذلك من ابتلاع العوالق النباتية والبكتيريا الأخرى (هاكيت ، أندرسون وآخرون ، 2004). دعماً لنموذج ابتلاع الفريسة ، يشير العمل السابق إلى أن الجينومات النووية للدينوفلاجيل تحتوي على عدد كبير من الجينات المكتسبة عن طريق التعايش الداخلي البلاستيد بالإضافة إلى الجينات المكتسبة أفقياً من مصادر أخرى (Hackett et al. 2005 ، 2013 Nosenko et al. 2006 Nosenko and Bhattacharya) 2007 Janouskovec et al. 2010 Minge et al. 2010 Wisecaver and Hackett 2010 Stuken et al. 2011 Chan et al. 2012 Orr et al. 2013). يتم حل وضع دينوفلاجيلات ودعمه جيدًا في تحليلات التطور ، وهو أمر ضروري لاستنتاج HGT بناءً على التناقض النشئي بين الجينات وأشجار الأنواع. Dinoflagellates هي شقيقة Perkinsidae ، وهي مجموعة طفيلية تضم مسببات أمراض المحار بيركنسوس مارينوس (ريس وآخرون 1997). Dinoflagellates و Perkinsidae معًا هما أختان لـ apicomplexans ، وهي مجموعة طفيلية حصرية مسؤولة عن العديد من الأمراض البشرية بما في ذلك الملاريا وداء المقوسات (Fast et al. 2002). أقرب مجموعة بروتستية رئيسية إلى دينوفلاجيلات و apicomplexans هي ciliates ، وهذه السلالات الثلاثة معًا هي الأعضاء الأساسيون في superphylum Alveolata (Adl et al. 2005). تشير دراسات علم الوراثة إلى أن الحويصلات الهوائية مرتبطة بالستيرامينوبلات (مثل الدياتومات وعشب البحر العملاق) والجذريات (على سبيل المثال ، المنخربات والراديولاريان) وهي رابطة مختصرة باسم المجموعة الفائقة stramenopile - alveolate - rhizaria (SAR) (Burki et al. 2007 Parfrey et al. 2010). ومع ذلك ، على الرغم من هذا القرار النسبي بالإضافة إلى الحالات المنشورة لنقل الجينات ، فإن المدى الكامل والتوقيت والعواقب لـ HGT في دينوفلاجيلات لا تزال غير معروفة لأن أمثلة الجينومات لم يتم تسلسلها بعد.

يتراوح حجم جينومات Dinoflagellate من 1.5 إلى 185 جيجا بايت (0.8 إلى أكثر من 60 ضعف حجم الجينوم البشري) وهي مليئة بالتسلسل غير المشفر ، وتكرار الجينات الترادفية ، وغيرها من الميزات غير العادية التي تجعل تسلسل الجينوم باستخدام التكنولوجيا الحالية غير عملي للغاية مع التجميع الحالي التكنولوجيا (Wisecaver and Hackett 2011). لحسن الحظ ، يعد تسلسل النسخ طريقة بديلة للأسئلة التي تتطلب اكتشافًا جينيًا شاملاً في الكائنات الحية غير النموذجية ذات الجينومات المعقدة. هنا ، نقوم بتحليل تجميع نسخ دي نوفو شامل لـ dinoflagellate ، الكسندريوم تامارينسي سلالة CCMP1598 ، وهو عضو في كليد "المجموعة الرابعة" داخل A. تامارينسي مجمع الأنواع. يتألف مجمع الأنواع هذا من خمس مجموعات كليد من هذا القبيل والتي من المحتمل أن تمثل كل منها نوعًا خفيًا مميزًا (Lilly et al.2007). نحن نقوم بمراجعة ملفات A. تامارينسي تم تعيين جين المجموعة الرابعة على بيانات علامة التسلسل النسبي والمعبر عنها (EST) من 21 نوعًا إضافيًا من السوطيات (بما في ذلك مجموعات النسخ من A. تامارينسي سلالات المجموعة الأولى والمجموعة الثالثة) لاشتقاق مجموعة unigene نهائية من دينوفلاجيلات ثم نقارنها مع 16 جينومًا آخر من الطحالب والبروستات. باستخدام إعادة بناء محتوى الجينات الموروثة ، نقوم بتعيين عمليات الاستحواذ الجيني على شجرة التطور الحويصلي والتحقق من صحة النتائج باستخدام خط أنابيب نسالة. يقدم هذا النهج المشترك استكشافًا قويًا ومقارنًا لنمط HGT في دينوفلاجيلات بالنسبة إلى حقيقيات النوى الأخرى.


مناقشة

على سبيل المثال التمثيل الغذائي المركزي والأحماض الأمينية في B. الرقيقة، نظهر أن التنميط المتدفق من خلال الإحصاءات متعددة المتغيرات من تحليل توزيع النظائر الكتلي مفيد للتمييز بين المسوخ أو الظروف على أساس سلوكهم الأيضي ، وقابل للتطبيق على الظروف التي يتعذر الوصول إليها لتحليل التدفق السابق. في تناقض حاد مع بيانات تركيز الأيض [24 ، 25] ، تحتوي ملامح فلوكسوم على معلومات وظيفية عن تشغيل الشبكات المجمعة بالكامل [1 ، 4]. كما هو موضح هنا من قبل ICA ، يمكّننا هذا النهج من استخلاص التواقيع الأساسية للأنشطة الأيضية المستقلة ، ويدعم تحديد السببية الكيميائية الحيوية الأساسية. لأنه لا يوجد نموذج أو بداهة مطلوب معرفة النظام الذي تم فحصه ، ويمكن اتباع البصمات الأيضية لأي ذرة وجزيء تتبع في أي نظام بيولوجي تقريبًا ، بما في ذلك الكائنات متعددة الخلايا في وسائط معقدة متعددة الركائز.

بصورة مماثلة، بداهة معرفة عدد الدوائر المتكاملة التي سيتم حسابها ليست شرطا مسبقا. في واقع الأمر ، يعتمد الرقم الأمثل بشكل أساسي على أنماط وضع العلامات ولا يمكن تقديره من أبعاد مجموعة البيانات. سيؤدي التقليل من التقدير بشكل عام إلى ترك بعض التواقيع ذات الصلة غير معروفة ، في حين أن المبالغة في التقدير ستؤدي إلى جزء متزايد من المكونات التي تعكس القياس أو الضوضاء البيولوجية. على الرغم من أنه يمكن تقييم الأهمية الإحصائية من خلال التكرارات ، إلا أن ذلك يصبح محظورًا مع مجموعات البيانات الكبيرة (أي مئات المسوخ أو التحليلات) أو انخفاض توافر النسخ المتماثلة. يكمن عنق الزجاجة في النهج العشوائي لمعظم خوارزميات ICA ، حيث تؤدي عمليات التشغيل المستقلة إلى دوائر متكاملة مختلفة أو ترتيبها. بدلاً من ذلك ، يمكن تقييم الموثوقية الحسابية والإحصائية لـ ICs من خلال تكرار التقدير عدة مرات إما مع التخمينات الأولية المختارة عشوائيًا أو عن طريق تغيير مجموعة البيانات بشكل طفيف (bootstrapping [28]) ، على التوالي ، ثم تجميع جميع النتائج لتحديد الدوائر المتكاملة القوية [29] ].

هناك عاملان يؤثران بشكل مباشر على النتائج التي يمكن الحصول عليها من خلال التنميط المتدفق المقارن: التحليلات المكتشفة واختيار التتبع النظيري. بالإضافة إلى التحليلات القائمة على البوليمر مثل الأحماض الأمينية البروتينية التي يتم مراقبتها هنا ، يمكن اكتشاف ملفات تعريف الجريان في أي مجموعة من المستقلبات داخل أو خارج الخلية ، وبالتالي توسيع عمليات التمثيل الغذائي التي يمكن ملاحظتها يعتمد اختيار التتبع ، إلى حد ما ، على التمثيل الغذائي النظام الفرعي للمصلحة. توفر الركائز المصنفة بشكل موحد منظورًا عالميًا أكثر لأنها تسمح بتقييم التدافع لأي عمود فقري للكربون ، وفي حالة التجارب التي يتم إجراؤها في الوسائط الغنية ، تسمح أيضًا بتحديد مقدار جزء من من جديد التخليق الحيوي من التتبع بالنسبة إلى امتصاص مكون متوسط. وبالمثل ، فإن ركائز deutered بشكل موحد أو 2 H.2تعتبر O ذات قيمة في التقاط عدد كبير من الدوائر المتكاملة في وقت واحد والتي تتأثر بإطلاق وربط وتبادل الماء أو البروتونات. على النقيض من ذلك ، فإن الركائز التي تم تصنيفها في مواقع محددة تتيح استجوابًا أعمق لشبكات فرعية معينة ، على سبيل المثال ، [1 - 13 C] hexoses للتفاعلات التقويضية الأولية [8 ، 19] أو [1-13 C] الأسبارتات لتقييم نشاط دورة اليوريا.

كشفت النتائج أيضًا عن معلومات بيولوجية جديدة حول نشاط المسار أو الوظيفة أو التنظيم. أولاً ، كل من تحلل السكر ومسار فوسفات البنتوز يعمل على تقويض الجلوكوز بنشاط في وجود CAA ، لأن pgi و yqjI كانت التواقيع الطافرة مختلفة عن النوع البري وعن بعضها البعض. على النقيض من ذلك ، كانت نفس الطفرات على السوربيتول متشابهة جدًا مع النوع البري ، مما يشير إلى أن كلا التفاعلين متورطان بشكل هامشي في تقويض هذا السكر. ثانيًا ، كان تدفق دورة كريبس مشابهًا للجلوكوز والسوربيتول (مع وبدون CAA) ، كما تم استنتاجه من التوقيعات الواضحة المماثلة لـ sdhC متحولة. ثالثًا ، غياب sdhC التوقيعات في الأحماض الأمينية المشتقة من دورة كريبس الأسبارتات والغلوتامات مده متحولة عندما تنمو مع الأمونيوم (ولكن ليس CAA) يشير إلى نشاط تجاوز البيروفات القائم على إنزيم الماليك [30]. رابعًا ، يبدو أن نشاط إنزيم الماليك المعتمد على NADP مستقل عن قمع الهدم بسبب التواقيع الواضحة لـ ytsJ متحولة شوهدت على جميع الركائز. على النقيض من ذلك ، كان مركب phosphoenolpyruvate synthetase Pps غير نشط في وجود الجلوكوز المثبط ولكنه نشط على البيروفات أو السوربيتول. خامسًا ، كما نوقش أعلاه ، تكشف البيانات عن تأثير كريبس المعزز لدورة المثبط CggR على السوربيتول ولكن ليس على الجلوكوز ، على الأرجح من خلال قمع الجينات الحالة للجلوكوز [22].

يكمل التنميط المتدفق المقارن المقدم هنا تحليل التدفق التقليدي لأنه يتيح تحديدًا سريعًا وآليًا للطفرات أو الظروف ذات الصلة من مجموعات البيانات واسعة النطاق ، على سبيل المثال من مكتبات متحولة كاملة. النهج كمي من حيث الاختلاف النسبي بين المتغيرات ، ولكن النوعي فيما يتعلق في الجسم الحي تدفق. ثم تخضع المتغيرات المثيرة للاهتمام لاستجواب أعمق لظاهرة التمثيل الغذائي المحددة المحددة. إلى جانب التنقيب في البيانات ، فإن التنميط المتدفق لديه أيضًا القدرة على تحديد السمات الوظيفية المعقدة في الخلايا الأعلى حيث تفشل طرق التدفق الحالية ، وربما حتى تحديد الآلية الكيميائية الحيوية الكامنة وراء التوقيعات النظيرية للكتلة المميزة.


أساليب

السلالات والبلازميدات

بكتريا قولونية تم استخدام DH10B للاستنساخ. بكتريا قولونية تم استخدام BLR (DE3) و DH1 لدراسات التعبير مع نواقل BglBrick. تم سرد البلازميدات وأجزاء BglBrick المستخدمة في هذه الدراسة في الجدول 1. تم استكمال الوسائط بـ 100 ميكروغرام / مل من الأمبيسيلين ، 35 ميكروغرام / مل كلورامفينيكول ، أو 50 ميكروغرام / مل كاناميسين للاختيار لصيانة البلازميد. نمت جميع السلالات عند 30 درجة مئوية ما لم يتم وصف خلاف ذلك.

بناء أجزاء ناقلات BglBrick

يتم سرد بلازميدات القالب أو أجزاء نواقل BglBrick التي تم إنشاؤها هنا في الجدول 1 ويتم سرد الاشعال لتضخيم PCR في الجدول 2. وقد تم تضخيم كل مكون من مكونات الجين إما PCR من قالب باستخدام Phusion ™ High-Fidelity DNA polymerase (نيو إنجلاند) BioLabs ، F-530) أو هضمها من بلازميدات القالب ودمجها في بلازميد ناقل BglBrick عن طريق طريقة الهضم / الربط المعيارية.

أصول النسخ المتماثل

تم الحصول على أصل p15A من البلازميد pZA31-luc ، وأصل ColE1 من البلازميد pZE12-luc ، والأصل pSC101 * من البلازميد pZS * 24-MCS1 [39]. أ BglII تم التخلص من الموقع في الأصل pSC101 * عن طريق الطفرات الموجهة للموقع. قليل النوكليوتيدات المستخدمة لإزالة BglII الموقع في الأصل pSC101 * كان pSC101QC F1 و pSC101QC R1 مما أدى إلى إنشاء pSC101 **. تم استنساخ كل أصل من وحدة تسلسل النسخ المتماثل والنهاية باستخدام أفري و ساسي المواقع. تم استخدام البلازميد pMBIS كقالب لأصل pBBR1. تم تضخيم منطقة BBR1 إلى جزأين ، وتم تصميم البادئات لإحداث طفرة من النقطة C إلى T في المنطقة المتداخلة لمنتجي PCR لزيادة عدد النسخ كما ورد [22]. تم استخدام التمهيدي الأمامي pBBR1 F1 (5'- gatcaCCTAGGctacagccgatagtctggaacagcgc -3 ') والتمهيدي العكسي pBBR1 mut R1 (5'- ccggcaccgtgtTggcctacgtggtc -3') لإنشاء المنتج الأول باستخدام 5'-أفري تم استخدام الموقع ، والتمهيدي الأمامي pBBR1 mut F1 (5'- gaccacgtaggccAacacggtgccgg -3 ') والتمهيدي العكسي pBBR1 R2 (5'- agatcaACTAGTgcctccggcctgcggcctgcgcgcttcg -3') لإنشاء المنتج الثاني مع 3'- SpeI موقع. تم بعد ذلك دمج هذين الجزأين في تفاعل تداخل لصق امتداد PCR (SOE-PCR) مع البادئات pBBR1 F1 و pBBR1 R2 لإنشاء المنتج الذي يحتوي على أصل pBBR1 الكامل للنسخ المتماثل. تم هضم منتج PCR باستخدام أفري و SpeI وربطها بالنواقل الوسيطة الموجودة لتوليد ثلاثة نواقل وسيطة إضافية تحتوي على pBBR1 وكل وحدة مقاومة للمضادات الحيوية.

مقاومة المضادات الحيوية

جميع شرائح مقاومة المضادات الحيوية (ساسي إلى آاتي) من البلازميدات الأصل المدرجة في الجدول 1. تمت إزالة موقع تقييد BglBrick الموجود في مكونات الجين المقاومة Cm و Km عن طريق الطفرات الخاصة بالموقع. قليل النوكليوتيدات المستخدمة لإزالة ايكو ارى كان الموقع في جين المقاومة Cm هو CmQC F1 الأمامي (5'-ctttcattgccatacgAaattccggatgagcattc-3 ') وعكس CmQC R1 (5'-gaatgctcatccggaattTcgtatggcaatgaaag-3') (يتم رسملة طفرة النقطة). قليل النوكليوتيدات المستخدمة لإزالة BglII الموقع في المروج الجيني لمقاومة Km كان KanQC F1 (5'- cctgtcttgatcagatcAtgatcccctgc-3 ') و KanQC R1 (5'- gcaggggatcaTgatctgatcaagagacagg-3').

Rfp (أو gfp) والمنهي

تم إنشاء الوحدة النمطية rfp-terminator (rfp-term) عن طريق تمديد تداخل لصق- PCR (SOE-PCR [47]. أولاً ، تم إجراء SOE-PCR لتوليد rfp مع مواقع تقييد BglBrick ايكو ارى و BglII و RBS (TTTAAGAAGGAGATATACAT) على الطرف 5 ، ومع مواقع تقييد BglBrick بامهي و XhoI وتسلسل فاصل مزدوج متبوعًا بعلامة آاتي الموقع في النهاية 3. تم إجراء اثنين من PCRs لتضخيم rfp والمنهي بشكل منفصل ، باستخدام البادئات لتقديم مواقع التقييد ، و RBS ، والتسلسل المتداخل لـ SOE-PCR. تم استخدام التمهيدي الأمامي RFP F1 والتمهيدي العكسي RFP R1 لتوليد المنتج المحتوي إيكو ري ، BglIIو RBS و rfp. تم استخدام التمهيدي الأمامي المصطلح F1 والتمهيدي العكسي المصطلح R1 لإنشاء المنتج الذي يحتوي على بامهي ، XhoI، وتسلسل فاصل مزدوج و أفري. تم بعد ذلك دمج المنتجات وتم إجراء PCR ثانٍ باستخدام RFP F1 و Term R1. منتج SOE-PCR الناتج (rfp-term) في تقارير SOE-PCR إضافية لإنشاء وحدات كاملة تحتوي على 8 أنظمة محفز مختلفة تليها rfp-مصطلح.

المروجين والمثبطين

تم تصميم البادئات لكل نظام مروج (يحتوي على مثبط ومحفز) لتشمل 5 'آاتي موقع لخطوات الاستنساخ اللاحقة وملف rfp تداخل تسلسل على الطرف 3 لتسهيل إضافة rfp- وحدة إنهاء عبر SOE-PCR. عندما احتوى نظام المروج على أي من مواقع تقييد BglBrick الأربعة ، تم إعداد مجموعة إضافية من البادئات لإزالة موقع التقييد لـ SOE-PCR. يتم سرد الاشعال لكل نظام مروج في الجدول 2.

تجميع ناقل pBb النهائي

لبناء نظام المروج مع rfp- وحدة إنهاء ، تم دمج كل من وحدات نظام المروج الثمانية مع rfp- أداة إنهاء بواسطة SOE-PCR باستخدام التمهيدي F1 من كل بناء نظام مروج والعكس التمهيدي المصطلح R1. ثم تم هضم هذه المنتجات الثمانية باستخدام آاتي و أفري ومربوطة بشكل فردي مع آاتي و أفري جزء مهضوم من وسيط يحتوي على البلازميد أمبير R و ColE1. ثم تم هضم ال 11 من البلازميدات الوسيطة المتبقية مع أفري و آاتي لعزل وحدات منشأ مقاومة المضادات الحيوية (AR-ori). في المجموع ، تم ربط كل من وحدات AR-ori الاثني عشر مع كل من الوحدات الثمانية أفري و آاتي وحدات مروج-rfp-terminator المهضومة لإنتاج 96 متجهًا فريدًا من pBb.

تجارب ورقة البيانات

عام

تم تحويل بلازميدات pBb المقاومة للأمبيسيلين إلى بكتريا قولونية BLR (DE3) خلايا كهربائية و / أو بكتريا قولونية خلايا DH1 الكهربية ومطلية على LB-agar مع 50 ميكروغرام / مل من Carbenicillin (Cb) للحضانة طوال الليل عند 37 درجة مئوية. تم اختيار مستعمرة واحدة واستخدامها لتحضير ثقافة البذور في مرق LB يحتوي على 50 ميكروغرام / مل من الكارب. تم تلقيح أنابيب استنبات طازجة مع 3 مل من مرق LB تحتوي على 50 ميكروغرام / مل Cb ب 60 ميكرولتر من ثقافة البذور طوال الليل ونمت عند 37 درجة مئوية ، 200 دورة في الدقيقة حتى OD600 بلغ حوالي 0.55. تم تكرار جميع التجارب في ثلاث نسخ.

استجابة جرعة المحرض

تم ملء الآبار الخارجية لصفيحة سفلية صافية 96 بئر مع غطاء (Corning no: 3631) بـ 200 ميكرولتر من الماء المعقم وتم تعقيم اللوحة باستخدام تشابك الأمثل الإعداد على الرابط المتشابك للأشعة فوق البنفسجية (Spectronics ، Corp.). تم إجراء تخفيفات متسلسلة 10 × من محرضات مناسبة لكل بلازميد يتم اختباره وتم ضخ 20 ميكرولتر في كل بئر بحيث يعطي الحجم النهائي البالغ 200 ميكرولتر تركيز محفز 1x. تضمنت كل لوحة 3 آبار تحكم تحتوي على pBbE5a-RFP (أو GFP) في BLR (DE3) المستحثة بـ 12.5 ميكرومتر IPTG. تمت إضافة كميات مناسبة من الثقافة و LB / Cb إلى لوحة 96 بئر مع غطاء ونمت في قارئ صفيحة صفيحة Safire (Tecan) عند 30 درجة مئوية لمدة 20.5 ساعة. التطوير التنظيمي600 تم قياس تألق RFP كل 570 ثانية باستخدام طول موجة إثارة 584 نانومتر وطول موجة انبعاث 607 نانومتر. بالنسبة للتركيبات التي تحتوي على GFP (بلازميدات pBbB) ، تم استخدام طول موجة إثارة يبلغ 400 نانومتر وطول موجة انبعاث يبلغ 510 نانومتر لقياس التألق.

الإجهاد والاعتماد المتوسط

بكتريا قولونية تم وضع خط BLR (DE3) و DH1 المحول ببلازميد pBb على LB-agar مع 50 ميكروغرام / مل Cb ونما عند 37 درجة مئوية طوال الليل. تم تحضير مزارع البذور في مرق LB يحتوي على 50 ميكروغرام / مل من Cb تلقيح مستعمرة واحدة ونمت عند 37 درجة مئوية ، 200 دورة في الدقيقة بين عشية وضحاها. تم تكرار كل تجربة باستخدام سلالة تؤوي البلازميد pBb في ثلاث نسخ ، وتضمنت كل مجموعة من التجارب 6 أنابيب تحكم تحتوي على pBbE5a-RFP في BLR (DE3) في LB (3 غير مستحث و 3 مستحث بـ 100 ميكرومتر IPTG). بالنسبة لتجربة M9 المتوسطة (MM) ، تم إجراء ثلاث جولات من التكيف في متوسط ​​الحد الأدنى. بعد التكيف ، تم تلقيح أنابيب طازجة مع 3 مل MM طازج بزراعة بذور متكيفة مع OD600 حوالي 0.15 ونمت عند 37 درجة مئوية إلى OD600 حوالي 0.5.تم تحريض مجموعة واحدة من الأنابيب بتركيزات مختلفة من المحرض ونمت جميع الثقافات عند 30 درجة مئوية ، 200 دورة في الدقيقة لمدة 66 ساعة بعد الحث. تم أخذ العينات في 18 ساعة و 42 ساعة و 66 ساعة بعد الحث. تم أخذ 25 ميكرولتر من الثقافة في صفيحة 96 بئر وتم تخفيفها إلى 200 ميكرولتر مع وسط جديد ، و OD600 وتم قياس التألق. بالنسبة لتجارب وسائط LB و TB ، تم استخدام مزارع البذور بين عشية وضحاها مباشرة للتلقيح دون تكيف.

قمع Catabolite وحفز الحديث المتبادل

تم تحضير مزارع البذور كما هو موصوف في تجارب السلالة والاعتماد المتوسط. تم استخدام ثلاث وسائط مختلفة (MM ، الفوسفات المخزن LB ، والفوسفات المخزن من السل) التي تحتوي على 1 ٪ جلوكوز لتجارب قمع الهدم. نمت الثقافات الملقحة عند 37 درجة مئوية إلى OD600 حوالي 0.5 ، ويتم حثه لتحقيق أقصى تعبير (100 ميكرومتر IPTG ، 20 ملي أرابينوز ، 400 نانومتر aTc ، أو 20 ملي بروبيونات). نمت الثقافات عند 30 درجة مئوية ، 200 دورة في الدقيقة لمدة 66 ساعة بعد الحث ، و OD600 وتم قياس التألق في كل أخذ العينات. بالنسبة لتجربة الحديث المتبادل للمحفز ، تم تلقيح مرق LB المحتوي على 50 ميكروغرام / مل من Cb بمزارع بذور تحتوي على بكتريا قولونية يحتوي BLR (DE3) على pBb المقاوم للأمبيسيلين. تم إحداث الثقافات في OD600 حوالي 0.5 مع المحرض المناسب ، كما تمت إضافة أحد المحرضات غير المتشابهة إلى الثقافة المستحثة بشكل فردي أثناء الحث. نمت الثقافات عند 30 درجة مئوية ، 200 دورة في الدقيقة لمدة 18 ساعة بعد الحث ، و OD600 وتم قياس التألق باستخدام Tecan.

عزل الحمض النووي البكتيري لتحديد عدد نسخة البلازميد

بكتريا قولونية تمت زراعة DH1 و BLR طوال الليل عند 30 درجة مئوية ، اهتزاز 200 دورة في الدقيقة بعد تلقيح 5 مل مزارع من وسط LB (مكمل بـ 50 ميكروغرام / مل كاناميسين) مع مستعمرات مفردة من ألواح مخططة حديثًا. بعد الزراعة الفرعية (1:50) في قوارير اهتزاز تحتوي على 50 مل من وسط LB (مكمل بـ 50 ميكروغرام / مل كاناميسين) ، نمت الخلايا عند 30 درجة مئوية ، و 200 دورة في الدقيقة تهتز حتى OD600 تم الوصول إلى 0.3-0.4. في هذا الوقت ، تم غزل 1 مل من الخلايا وإزالة المادة الطافية لاحقًا. ثم تم تجميد كريات الخلايا. تم عزل الحمض النووي الكلي من هذه الكريات لاستخدامها في تاريخ لاحق. تم اعتماد طريقة عزل الحمض النووي الواردة في المنشورات السابقة [33 ، 48]. تم تعليق كريات الخلايا البكتيرية في 400 ميكرولتر من 50 ملي مولار تريس / 50 ملي EDTA ، درجة الحموضة 8 ، عن طريق الدوامة. تم نفاذ أغشية الخلايا بإضافة 8 ميكرولتر من 50 مجم / مل من الليزوزيم (سيغما) في 10 ملي مولار تريس / 1 ملي EDTA ، درجة الحموضة 8 ، متبوعًا بالحضانة عند 37 درجة مئوية لمدة 30 دقيقة. لإكمال تحلل الخلية ، تمت إضافة 4 ميكرولتر من 10 ٪ SDS و 8 ميكرولتر من 20 مجم / مل من محلول بروتين K (Invitrogen) إلى كل أنبوب ، وخلط مع حقنة مع إبرة قياس 21 ، 1.5 بوصة ، وحضنت عند 50 درجة C لمدة 30 دقيقة. تم تعطيل حرارة بروتيناز K بعد ذلك عند 75 درجة مئوية لمدة 10 دقائق ، وتم هضم الحمض النووي الريبي بإضافة 2 ميكرولتر من محلول RNase A (Qiagen) متبوعًا بحضانة عند 37 درجة مئوية لمدة 30 دقيقة. ثم بدأ الاستخراج الكلي للحمض النووي بإضافة 425 ميكرولتر من 25:24: 1 فينول: كلوروفورم: كحول أيزو أميل ، دوامة بقوة من أجل

دقيقة واحدة ، مما يسمح للأنابيب بالجلوس في درجة حرارة الغرفة لبضع دقائق ، ثم بالطرد المركزي لمدة 5 دقائق عند 14000 × جم ، 4 درجات مئوية. بعد ذلك ، تم نقل 300 ميكرولتر من المرحلة المائية العلوية إلى أنبوب جديد باستخدام طرف ماصة ذو فتحة واسعة. استمر استخراج الحمض النووي عن طريق إضافة 400 ميكرولتر من الكلوروفورم لكل أنبوب ، دوامة قوية ل

دقيقة واحدة ، مما يسمح للأنابيب بالجلوس في درجة حرارة الغرفة لبضع دقائق ، والطرد المركزي لمدة 5 دقائق عند 14000 × جم ، 4 درجات مئوية. بعد ذلك ، تم نقل 200 ميكرولتر من المرحلة المائية العلوية إلى أنبوب جديد باستخدام طرف ماصة ذو فتحة واسعة. بعد استخراج الكلوروفورم ، تم ترسيب إجمالي الحمض النووي من الإيثانول طوال الليل ، وغسله بنسبة 70 ٪ من الإيثانول ، ثم أعيد تعليقه أخيرًا في 40 ميكرولتر من الماء الخالي من نوكلياز. تم تقييم تركيز ونقاوة الحمض النووي باستخدام مقياس الطيف الضوئي Nanodrop ، وفحصت سلامة المواد الهلامية على 1٪ agarose.

التقدير الكمي qPCR في الوقت الحقيقي لرقم نسخة البلازميد

مجموعات التمهيدي الخاصة بـ neomycin phosphotransferase II (nptII) الجين (إلى الأمام: GCGTGGCTACCCGTGATAT ، والعكس: AGGAAGCGGTCAGCCCAT) [49] وجين 16S rDNA (إلى الأمام: CCGGATTGGAGTCTGCAACT ، عكسي: GTGGCATTCTGATCCACGATTAC) [33] تم استخدامها لـ qPCR في الوقت الحقيقي. تضخّم هذه البادئات منتجًا واحدًا بالحجم المتوقع كما تؤكده درجات حرارة انصهار الأمبليكون. nptII يتواجد في نسخة واحدة على البلازميدات المميزة في هذه الدراسة ، بينما يتواجد جين 16S rDNA على نسخ متعددة على بكتريا قولونية كروموسوم [36] وكان يستخدم للتطبيع [22 ، 33 ، 35]. من أجل تحديد رقم نسخة البلازميد (أي عدد البلازميدات لكل مكافئ جيني) ، بكتريا قولونية سلالات DH1 و BLR المعدلة وراثيا مع واحد nptII تم استخدام التكامل (البيانات غير معروضة) للمعايرة. تم هضم إجمالي الحمض النووي المعزول من كل سلالة أولاً بين عشية وضحاها باستخدام ايكو أنا (نيو إنجلاند بيولابس) عند 37 درجة مئوية. تم إجراء qPCR في الوقت الفعلي على BioRad iCycler مع كتل تفاعل 96 بئر في وجود SYBR Green في ظل الظروف التالية: 1X iQ SYBR Green Supermix (BioRad) ، 150 نانومتر nptII (500 نانومتر 16S) الاشعال في رد فعل 25 ميكرولتر. كانت دورة qPCR في الوقت الفعلي 95 درجة مئوية لمدة 3 دقائق ، تليها 40 دورة من 30 ثانية عند 95 درجة مئوية ، و 30 ثانية عند 60 درجة مئوية ، و 30 ثانية عند 72 درجة مئوية. تم تحديد دورات العتبة (Ct) باستخدام برنامج iCycler (BioRad) لجميع العينات. تم إعداد منحنى قياسي للقياس الكمي. لهذا الغرض ، تم تحضير سلسلة تخفيف بأربعة أضعاف من إجمالي سبع تخفيفات من عينة الحمض النووي الكلية المهضومة ، وتعرض كل تخفيف لتحليل qPCR في نسختين على الأقل مع أي من nptII- أو بادئات خاصة بـ 16S. تم استخدام قيم Ct التي تم الحصول عليها بواسطة حزمة برامج iCycler لرسم منحنى قياسي يسمح بالتقدير الكمي لـ nptII أو 16S في عينات الحمض النووي الكلية المهضومة (أي المجهول) بالنسبة لعينة الحمض النووي المستخدمة لإعداد المنحنى القياسي.

التحكم في التعبير في نظام ثلاثي البلازميد

تم تحويل خلايا BLR (DE3) بثلاثة بلازميدات: pBbA8a-CFP و pBbE5c-YFP و pBbS2k-RFP. تم استخدام مستعمرة واحدة لتلقيح وسط LB ونمت الثقافات بين عشية وضحاها عند 37 درجة مئوية في متوسط ​​الحد الأدنى (وسط M9 مزود بـ 75 ملي مولار مابس ، 2 ملي مولار MgSO4، 1 مجم / لتر ثيامين ، 10 نانومتر FeSO4، 0.1 ملي كاكل2 والمغذيات الدقيقة) مع 2٪ جلوكوز. تم إحداث الخلايا في OD

0.6 مع توليفات من كميات مختلفة من أرابينوز و IPTG و aTc. بالتفصيل ، كانت تركيزات أرابينوز المستخدمة 0 و 5 ملي مولار و 20 ملي مولار ، وكانت تركيزات IPTG المستخدمة 0 و 30 ميكرومتر و 100 ميكرومتر وكانت تركيزات aTc المستخدمة 0 و 12.5 نانومتر و 25 نانومتر و 40 نانومتر. بعد الحث ، نمت الخلايا عند 30 درجة مئوية لمدة 12 ساعة حتى تم قياس تألق ثقافة الخلية. تم تسجيل تألق ثقافة الخلية على قارئ لوحة SpectraMax M2 (الأجهزة الجزيئية) باستخدام لوحات كوستار 96 بئر مع كل بئر يحتوي على 150 ميكرولتر من ثقافة الخلية. بالنسبة لـ CFP ، λالسابق = 433 نانومتر و λم = 474 نانومتر استخدمت ل YFP ، λالسابق = 500 نانومتر و λم تم استخدام = 530 نانومتر ولطلب تقديم العروض ، λالسابق = 584 نانومتر و λم = 615 نانومتر تم استخدامها. تم تقدير كثافة الخلية عن طريق قياس الامتصاصية عند 610 نانومتر. تم تطبيع مضان ثقافة الخلية من كل بئر من خلال كثافة الخلية. كانت جميع البيانات في المتوسط ​​من قياسين مستقلين على الأقل.


شاهد الفيديو: دور الكربون في تشكيل الجزيئات الحيوية الكبيرة أحياء حادي عشر فصل دراسي أول سلطنة عمان (يوليو 2022).


تعليقات:

  1. Jazzalyn

    تمت زيارتها من قبل الفكر الرائع

  2. Usk-Water

    في رأيي ، إنه فعلي ، سأشارك في المناقشة.

  3. Dougore

    إنه الاستثناء إلى حد بعيد

  4. Nevada

    إنه مثير للاهتمام. من فضلك قل لي - أين يمكنني العثور على مزيد من المعلومات حول هذا الموضوع؟

  5. Shagar

    هذا لم يأخذ.

  6. Nijin

    ما هي الكلمات الصحيحة ... سوبر ، فكرة رائعة

  7. Fitzsimon

    كيف حالك



اكتب رسالة