معلومة

هل خلايا شوان هي المصدر الوحيد لتكوين الميالين في الجهاز العصبي المحيطي؟

هل خلايا شوان هي المصدر الوحيد لتكوين الميالين في الجهاز العصبي المحيطي؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

هل خلايا شوان هي المصدر الوحيد للميلين بالنسبة للمحاور العصبية في الجهاز العصبي المحيطي ، أم أن هناك خلايا عصبية أخرى أو عمليات أخرى تؤدي إلى تكوّن النخاع في محاور الجهاز العصبي المحيطي؟


يبدو أن خلايا شوان هي النوع الأكثر شيوعًا من الخلايا الدبقية خارج الجهاز العصبي المركزي ، و خلايا شوان الميالينية هي المصدر الوحيد المعروف للميالين في الجهاز العصبي المحيطي. أنواع أخرى من الخلايا العصبية في الجهاز العصبي المحيطي ، على سبيل المثال خلايا شوان غير النخاعية والخلايا الشبيهة بالخلايا النجمية ، لا يبدو أنها تشارك في عملية تكوين الميالين ، لا في الجهاز العصبي المركزي ولا في الجهاز العصبي المحيطي.


بعد الإصابة ، احتفظت محاور الجهاز العصبي المحيطي بالقدرة على التجدد. في حين أنه من الثابت جيدًا أن إشارات الإصابة تتطلب محركات جزيئية لنقلها من موقع الإصابة إلى النواة ، إلا أن ما إذا كانت محركات كينيسين ودينين تلعب دورًا إضافيًا في تجديد الأعصاب المحيطية غير مفهومة جيدًا. هنا نستخدم المسوخات الجينية للبروتينات الحركية في نموذج تجديد العصب المحيطي لأسماك الزرد لتصور وتعريف في الجسم الحي أدوار كينيسين ودينين. وجدنا أن كلا من kinesin-1 و dynein مطلوبان لتجديد العصب المحيطي في الزرد. في حين أن فقدان kinesin-1 قلل من المتانة الكلية لإعادة نمو المحاور ، فإن فقدان الدينين أضعف بشكل كبير تجديد محور عصبي وقلل أيضًا من إعادة تشكيل خلية شوان الناجم عن الإصابة. تظهر الكيميرا بين النوع البري والأجنة المتحولة من نوع dynein أن وظيفة Dynein في الخلايا العصبية كافية لتعزيز إعادة نمو المحور العصبي. أخيرًا ، من خلال مراقبة ديناميكيات الأكتين والأنابيب الدقيقة في وقت واحد في تجديد المحاور ، نجد أن الدينين يبدو أنه يمكن الاستغناء عنه لبدء إعادة نمو المحاور ، ولكنه أمر بالغ الأهمية لتحقيق الاستقرار في الأنابيب الدقيقة ، وبالتالي الحفاظ على تجديد محور عصبي. تكشف هذه النتائج عن دورين لم يتم تقديرهما سابقًا للدينين أثناء تجديد الأعصاب المحيطية ، والبدء في إعادة تشكيل خلايا شوان المستحثة وتثبيت الأنابيب الدقيقة المحورية للحفاظ على إعادة نمو المحور العصبي.

يتطلب تجديد الأعصاب استجابات منسقة من أنواع خلايا متعددة بعد الإصابة. يجب أن تمتد المحاور من جسم الخلية العصبية إلى أهدافها ، بينما تدخل خلايا شوان المحيطة في حالة خلية إصلاح حيث تعزز التجدد. بينما يمكن أن تنمو أعصاب الجهاز العصبي المحيطي من جديد ، تشير التقديرات إلى أن أقل من 10 في المائة من المرضى يتعافون تمامًا من وظيفتهم بعد إصابة الأعصاب. من أجل فهم الآليات التي من خلالها تنمو الأعصاب الطرفية ، استخدمنا تصوير الخلية الحية في الزرد لمراقبة عملية تجديد الأعصاب ، ومراقبة المحاور وخلايا شوان في وقت واحد خلال هذه العملية. باستخدام المسوخات الجينية ، حددنا دورًا للمحركات الجزيئية kinesin-1 و dynein في تعزيز إعادة نمو المحور العصبي. علاوة على ذلك ، وجدنا أن الدينين يلعب دورًا إضافيًا في استجابة خلية شوان للإصابة. وبالتالي ، نوضح أن المحركات الجزيئية مطلوبة في أنواع خلايا متعددة لتعزيز تجديد الأعصاب.


المتفطرة الجذامية، العامل المسبب للجذام داخل الخلايا ، يصيب شوان مما يؤدي إلى إعاقات وتشوهات جسدية لا رجعة فيها. هذه الخلايا مسؤولة عن تكوين الميالين والحفاظ على استقلاب الطاقة المحوري من خلال تصدير المستقلبات ، مثل اللاكتات والبيروفات. في العمل الحالي ، لاحظنا أن خلايا شوان المصابة تزيد من امتصاص الجلوكوز مع زيادة مصاحبة في نشاط نازعة هيدروجين الجلوكوز 6 فوسفات (G6PDH) ، وهو الإنزيم الرئيسي لمسار البنتوز التأكسدي. لاحظنا أيضًا إغلاق الميتوكوندريا في الخلايا المصابة وتورم الميتوكوندريا في أعصاب الجذام العصبية النقية. تم وصف تأثير Warburg الكلاسيكي في البلاعم المصابة بـ المتفطرة الطيرية لم يلاحظ في نموذجنا ، والذي قدم انخفاضًا حادًا في توليد اللاكتات وإطلاقه بواسطة خلايا شوان المصابة. تبع هذا التأثير انخفاض في نشاط إسوفورم لاكتات ديهيدروجينيز M (LDH-M) وزيادة في الحماية الخلوية ضد إهانة بيروكسيد الهيدروجين في مسار فوسفات البنتوز وبطريقة تعتمد على GSH. M. الجذام كان نجاح العدوى يعتمد أيضًا على نظام الجلوتاثيون المضاد للأكسدة ومصدر طاقة الاختزال الرئيسي ، مسار البنتوز ، كما يتضح من انخفاض بنسبة 50 و 70 ٪ في الصلاحية داخل الخلايا بعد العلاج بمثبط تخليق GSH buthionine sulfoximine و aminonicotinamide (6-ANAM) ، وهو مثبط لـ G6PDH 6-ANAM ، على التوالي. خلصنا ذلك M. الجذام يمكن أن يعدل استقلاب الجلوكوز في الخلية المضيفة لزيادة توليد الطاقة المختزل الخلوي ، مما يسهل تجديد الجلوتاثيون وبالتالي التحكم في الجذور الحرة. تمت مناقشة تأثير هذا التنظيم في الاعتلال العصبي الجذامي.

يعلن المؤلفون أنه ليس لديهم تضارب في المصالح مع محتويات هذه المقالة.


خلايا شوان في اعتلال الأعصاب السكري

التغيرات المورفولوجية. تكشف عينات خزعة الأعصاب من مرضى السكري عن فقدان الألياف بشكل عام وتوجد مجموعات من المحاور المتجددة. غالبًا ما يتم الإبلاغ عن أقطار المحاور المنخفضة ، والتي تشير إلى ضعف النضج أو الضمور ، في نماذج الفئران لمرض السكري ، ولكنها ليست ميزة ملحوظة في العديد من نماذج الفئران أو البشر المصابين بداء السكري. ما إذا كان الاعتلال العصبي أو اعتلال شوانوباثي يتطور أولاً في الاعتلال العصبي السكري 25 قد نوقش منذ فترة طويلة ، وعينة خزعة عصبية واحدة ليست كافية لتحديد ما إذا كانت خلايا شوان تتعرض لضرر هيكلي مستقل أثناء مرض السكري أو تستجيب لتنكس محور عصبي. ومع ذلك ، تشير مستحضرات العصب الربلي من البشر والقطط والقوارض المصابين بداء السكري إلى تغيرات مورفولوجية في غمد الميالين - بدءًا من الميالين الرقيق الذي يشير إلى دورات إزالة الميالين وإعادة الميالين ، إلى إزالة الميالين القطعية الكاملة - في وجود محور عصبي طبيعي على ما يبدو ، مما يشير إلى يمكن أن يتطور اعتلال Schwannopathy بشكل مستقل عن اعتلال المحور العصبي 2،3،26،27،28 (الشكل 1). ومع ذلك ، يمكن أن تظهر الألياف الممزقة من نفس الأعصاب في الغالب علم أمراض محور عصبي ، مما يشير إلى أن مرض السكري يؤثر على كلا النوعين من الخلايا بشكل مستقل ، بالإضافة إلى تعطيل تفاعلاتهما. التغييرات التنكسية في الألياف العصبية مصحوبة بوجود ميتوكوندريا متضخمة مع عروق ممسحة والعديد من الفجوات في خلايا شوان 29 ، وهي ملاحظة تتفق مع الأدلة الناشئة على خلل وظيفي في الميتوكوندريا وتلف في المحاور وخلايا شوان في النماذج الحيوانية لمرض السكري 30. توجد أيضًا علامات مرضية متنوعة أخرى ، تتراوح من علامات غير محددة للإجهاد الخلوي إلى التنكس الخلوي الصريح ، في خلايا شوان من كل من النماذج الحيوانية لمرض السكري وعينات خزعة الأعصاب البشرية. تشمل التغييرات غير المحددة في خلايا شوان شوائب الجليكوجين ، والشوائب الليزوزومية ، وتراكم قطرات الدهون في السيتوبلازم ، والتوسع السيتوبلازمي ، وزيادة عدد الحويصلات البلازمية. تتضاعف الصفيحة القاعدية لخلية شوان أيضًا وتكثف 3،31. في إحدى الدراسات التي أُجريت على نموذج الفئران المصابة بداء السكري من النوع 1 ، انخفضت مستويات كبريتات الهيباران في الأغشية القاعدية لخلايا شوان في العقد الجذرية الظهرية تدريجياً مع زيادة مدة المرض ، مع زيادة متبادلة في اللامينين المترسب. تكهن مؤلفو هذه الدراسة بأن الزيادة المبكرة في كبريتات الهيباران يمكن أن تؤدي إلى تفاقم انتشار الألم ، بينما في المراحل المتقدمة من المرض ، يتم الحفاظ على تكوين الغشاء القاعدي عن طريق الإفراط في إنتاج اللامينين في خلايا شوان ، وبالتالي منع انتقال الألم والمحفزات العصبية الحرارية هذا. تساعد الفرضية على تفسير ملف تعريف الألم ثنائي النسق في الاعتلال العصبي السكري 32.

الاعتلال العصبي السكري له عملية إمراضية معقدة تنطوي على تفاعل اعتلال عصبي ، اعتلال شفاني واعتلال الأوعية الدموية الدقيقة. يوضح الشكل التنظيم التشريحي للمحاور النخاعية وغير المبطنة داخل الحزم العصبية. يتم تأمين إمدادهم بالمغذيات عن طريق الشعيرات الدموية الداخلية التي تشكل مع الغشاء المحيط بالبول الحاجز الدموي العصبي. أ | عينات خزعة جلد الإنسان محصنة بالمناعة بـ PGP9.5 لإظهار تقدم الأعصاب المحيطية من الأدمة إلى البشرة ، حيث توجد كألياف C صغيرة غير مائلة (شريط مقياس 40 ميكرومتر). تظهر اللوحة اليسرى فقدان الألياف لدى مريض مصاب باعتلال الأعصاب السكري واللوحة اليمنى تظهر الألياف في فرد سليم. ب | التغييرات في المحاور والميلين في الاعتلال العصبي السكري ، تظهر تنكس خلايا شوان والألياف العصبية ، وبلغت ذروتها في فقدان الألياف العصبية وداخل الجلد. ج | الشعيرات الدموية داخل العصب من مرضى السكري. تُظهر اللوحة العلوية شعيرات دموية من مريض غير مصاب باعتلال عصبي سكري ، وتوضح اللوحة السفلية شعيًا شعريًا من مريض مصاب باعتلال عصبي ، حيث أدى تضخم الخلايا البطانية وسماكة الغشاء القاعدي إلى تقليل حجم تجويف الشعيرات الدموية. د | قد لا يمنع تضييق الشعيرات الدموية الفردية الدم من المرور عبر السرير الشعري الداخلي في حد ذاته ، ولكن الزيادة الناتجة في سرعة الدم من خلال التحويلات الوظيفية داخل البولية أو التحويلات الشريانية الوريدية فوق البولية تمنع الاستخراج الفعال للأكسجين ، مما يتسبب في نقص الأكسجة. لوحة أ بإذن من الدكتور بال كارلسون ، المركز الدنماركي لأبحاث الألم ، قسم الطب السريري ، جامعة آرهوس ، الدنمارك.

تدفق مسار البوليول واختزال الألدوز. على مدار الخمسين عامًا الماضية ، أثبتت الأدلة الظرفية 33 و 34 التجريبية زيادات مدفوعة بفرط سكر الدم في التدفق من خلال مسار البوليول كأفضل آلية مسببة للأمراض مفهومة لاعتلال الأعصاب السكري. أظهرت العديد من الدراسات قبل السريرية أن تثبيط اختزال الألدوز (أول إنزيم في مسار البوليول) يمنع تقريبًا جميع مظاهر الاعتلال العصبي. ركزت الدراسات التي تم فيها التلاعب بتعبير الإنزيمات المشاركة في مسار البوليول تركيزًا خاصًا على العواقب الأيضية للاستقلاب المفرط للجلوكوز إلى السوربيتول بسبب ارتفاع نشاط إنزيم الألدوز 35 ، 36 ، 37 ، 38.

على أساس تورط مسار البوليول ، فإن تصور الاعتلال العصبي السكري باعتباره مضاعفات الأوعية الدموية الدقيقة لمرض السكري قد تم دعمه من خلال دراسات كيميائية مناعية أظهرت توطين اختزال الألدوز في الخلايا البطانية للأوعية الدموية لعقدة الجذور الظهارية وعقدة الجذور الظهرية والأوعية الدموية المتعاطفة حول الأوعية الدموية. محاور 39،40،41. في الواقع ، تشير البيانات الحديثة إلى نشاط اختزال الألدوز في إنتاج الإشارات البطانية المسببة للالتهاب والتخثر 42 ، وهي سلسلة مسببة للأمراض تلقى حاليًا اهتمامًا وثيقًا في سياق الاعتلال العصبي السكري 42 وتتم مناقشتها بالتفصيل أدناه (انظر قسم `` تغيرات الأوعية الدموية الدقيقة في شوان. خلايا). ومع ذلك ، داخل إندونيوريوم ، يقتصر اختزال الألدوز على خلايا شوان النخاعية للأعصاب الجسدية والخلايا الدبقية الساتلية في العقد الجذرية الظهرية 39،40،41 (المربع 3). يشير هذا التوطين إلى أن ضعف اختزال الألدوز لا يغير وظيفة الأوعية الدموية فقط ، على الرغم من أن هذه الملاحظة أدت إلى شيء من اللغز فيما يتعلق بالدور الممرض للإنزيم: يمكن أن تكون إزالة الميالين سمة من سمات اعتلال الأعصاب السكري عند الإنسان ، ولكن القوارض المصابة بداء السكري نادرًا ما تظهر أمراض خلايا شوان الملحوظة أو إزالة الميالين في الأعصاب الطرفية حتى فترة طويلة بعد اكتشاف الخلل الوظيفي العصبي 44،45 ، ما لم يكن الاعتلال العصبي مصحوبًا بضغوط أخرى ، مثل ارتفاع ضغط الدم 46. ومع ذلك ، فإن العديد من نماذج القوارض لمرض السكري تظهر مؤشرات على خلل في خلايا شوان ، بما في ذلك انخفاض التعبير عن البروتينات المرتبطة بالمايلين 47 والعوامل الغذائية المشتقة من خلايا شوان ، مثل CNTF 19 والقنفذ الصحراوي 20،48. هذه الاضطرابات لديها القدرة على التأثير على كل من وظيفة الخلايا العصبية 49 والأوعية الدموية 48 ، ويتم منع التغييرات في تعبير CNTF عن طريق تثبيط اختزال aldose reductase 50. بالإضافة إلى ذلك ، اقترحت الدراسات التي أجريت على خلايا شوان المستزرعة أن زيادة التدفق عبر مسار البوليول تدفع خلايا شوان نحو النمط الظاهري غير الناضج 51. علاوة على ذلك ، يمكن أن يؤدي تسمم الجالاكتوز ، الذي يزيد من نشاط مسار البوليول 52 ، إلى علم أمراض خلايا شوان الذي يوازي علم الأمراض الموجود في الاعتلال العصبي السكري عند الإنسان ، ويمكن الوقاية منه عن طريق تثبيط اختزال الألدوز. توضح هذه الملاحظة القدرة السامة للخلايا لزيادة التدفق من خلال مكون اختزال الألدوز في مسار البوليول ، وحقيقة أن الإجهاد الشديد مطلوب لتلف خلايا شوان ولكن لا يستدعي بالضرورة إزالة الميالين. قد تكون الزيادات التي يسببها ارتفاع السكر في الدم في تدفق مسار البوليول في خلايا شوان ، بالتالي ، آلية مسببة للأمراض الأولية التي تضعف دعمها الهيكلي والاستقلابي والغذائي للمحاور والأوعية الدموية قبل (أو بدون) مما يؤدي إلى إزالة الميالين الصريحة (الشكل 2). على الرغم من كونه مثيرًا للجدل كنموذج للاعتلال العصبي السكري ، فإن تسمم الجالاكتوز يسبب قوى تناضحية شديدة ووذمة ، مما يؤدي إلى ضغط الأوعية الدموية الدقيقة وتسليط الضوء على أهمية نقص الأكسجة الباطنية.

يؤدي فرط سكر الدم وعسر شحميات الدم في النهاية إلى تقليل الدعم العصبي من خلايا شوان والأوعية الدقيقة. في خلايا شوان ، تؤدي إشارات RAGE (مستقبل المنتجات النهائية للجليكوزيل المتقدم) إلى زيادة التمثيل الغذائي للجلوكوز عن طريق اختزال الألدوز ، الذي يولد ضررًا مؤكسدًا محليًا ، ويسبب الالتهاب ويدفع الخلايا إلى نمط ظاهري غير ناضج. كما أنه يؤثر على وظيفة الميتوكوندريا ، مما يزيد من استهلاك الأكسجين ، ويقلل من إنتاج القنفذ الصحراوي (DHH) ، مما يؤثر على وظيفة الخلايا البطانية. تعبر الخلايا البطانية أيضًا عن اختزال الألدوز ، وينشط تدفق مسار البوليول المتزايد المسارات الالتهابية والتخثرية التي تقلل من تدفق الدم في الأعصاب. يساهم اضطراب الدعم العصبي بواسطة خلايا شوان والجهاز الوعائي في الإصابة بالاعتلال العصبي ، بالتزامن مع التأثيرات المباشرة لمرض السكري على الخلايا العصبية نفسها.

تعتبر مثبطات اختزال الألدوز (ARIs) فعالة للغاية في النماذج الحيوانية للاعتلال العصبي السكري 55،56 ، لكن تطورها السريري كعلاج عند البشر قد توقف إلى حد كبير نتيجة لدراسات متعددة غير حاسمة أو سلبية 57. تم اقتراح تصميم التجارب السيئ وخيارات نقاط النهاية ، وفعالية الدواء المحدودة كعوامل مساهمة في هذا الفشل الترجمي 58. ومع ذلك ، لا تزال الموافقة التنظيمية على ARI epalrestat في اليابان هي المثال الوحيد على ترخيص دواء لعلاج الاعتلال العصبي السكري ، وقد أعادت تجربة حديثة للعدوى التنفسية الحادة في الأشخاص الذين يعانون من اعتلال الأعصاب الخفيف إلى المتوسط ​​التأكيد على النتائج السابقة 59 أن هذا النهج العلاجي يمكن أن يخفف من بعض مظاهر الاعتلال العصبي السكري 60. في قسم "تغيرات الأوعية الدموية الدقيقة ووظيفة خلايا شوان" أدناه ، نناقش نشاط مسار البوليول والتهابات الجهاز التنفسي الحادة من منظور توافر الركيزة لاستقلاب الطاقة العصبية.

الإجهاد التأكسدي وخلل الميتوكوندريا. أصبحت مساهمة الإجهاد التأكسدي واضطرابات الميتوكوندريا في خلايا شوان في خلل الخلايا العصبية أثناء مرض السكري واضحة بشكل متزايد. من المقبول على نطاق واسع ارتفاع سكر الدم المزمن كمحفز للإفراط في إنتاج أنواع الأكسجين التفاعلية (ROS) في جميع الخلايا ، كما هو الحال مع حقيقة أن هذه العملية السامة تتفاقم بسبب ما يصاحب ذلك من انخفاض في الدفاعات المضادة للأكسدة الذاتية. على سبيل المثال ، ارتبطت الاختلافات الجينية وتعدد الأشكال في إنزيمات مضادات الأكسدة الذاتية بزيادة القابلية للإصابة باعتلال الأعصاب السكري 62. تشمل المصادر المحتملة لـ ROS في الأعصاب الطرفية مسار البوليول ، وسلسلة نقل الإلكترون في الميتوكوندريا ، وإشارات RAGE (مستقبلات المنتجات النهائية للارتباط بالجليكوزيل المتقدم) ، وأكسيدات NADPH وتركيبات أكسيد النيتريك 63،64،65. يتم التعرف على خلايا شوان بشكل متزايد كموقع مهم لإنتاج أنواع الأكسجين التفاعلية ، والتي تؤثر ، في هذا السياق ، على وظيفة خلية شوان وتفاعلاتها مع أنواع الخلايا الأخرى داخل جذع العصب.

تشير العديد من الأدلة إلى أن الإجهاد التأكسدي في خلايا شوان يساهم في تلف الأعصاب في الاعتلال العصبي السكري. تشير التقارير إلى أن علاج التهابات الجهاز التنفسي الحادة يمنع الضرر التأكسدي للدهون والحمض النووي في أعصاب الفئران المصابة بداء السكري 66،67 تشير إلى أن زيادة التدفق عبر مسار البوليول يساهم في الإجهاد التأكسدي ، ويورط خلايا شوان في التسبب في هذا الإجهاد التأكسدي ، لأنها تعبر عن اختزال الألدوز. علاوة على ذلك ، يؤدي التدفق المتزايد عبر مسار البوليول إلى استنفاد NADPH العصاري الخلوي وبالتالي يقلل من مستويات الجلوتاثيون (أحد مضادات الأكسدة المهمة) ، مما يترك الخلايا العصبية وخلايا شوان عرضة للجذور السامة للأكسجين والبيروكسيدات. تعد إشارات RAGE المتغيرة في خلايا شوان آلية أخرى مقترحة لتلف الأعصاب الناجم عن ارتفاع السكر في الدم الناجم عن الجذور الحرة. يؤدي التكوين الزائد للمنتجات النهائية المتقدمة للجليكشن (AGE) نتيجة للجلوكوز الزائد إلى تنشيط RAGE ويؤدي إلى تكوين ROS 68 (الشكل 2). كشفت عينات خزعة العصب العصبي المأخوذة من مرضى السكري عن فرط التعبير عن RAGE في خلايا شوان 69 ، وقد تورطت إشارات RAGE في العديد من مضاعفات مرض السكري 70. علاوة على ذلك ، فإن التعديلات التي يسببها AGE للبروتينات الرئيسية (مثل الكولاجين) والدهون والأحماض النووية لديها القدرة على تغيير بنية ووظيفة خلايا شوان ، مع تأثيرات ضارة على المحاور العصبية التي تغلفها ، مما يؤدي إلى تقوية الاعتلال العصبي السكري 71. أخيرًا ، تم تحديد خلايا شوان على أنها بؤرة الإصابة التي تحدثها الجذور الحرة والمؤكسدات وتوسطها تنشيط بوليميريز بولي (ADP-ribose) ، وهو عامل مؤكسد للضغط التأكسدي والتآكل الذي يساهم أيضًا في تكوين جذور الأنيون الفائق والبيروكسينيتريت. في الأعصاب المحيطية لمرضى السكري 72. يمكن أن يؤدي ارتفاع السكر في الدم إلى زيادة إنتاج البيروكسينيتريت في جميع الخلايا العصبية ، وقد تبين أن البيروكسينيتريت بدوره بقايا التيروزين النترات لإنتاج 3-نيتروتيروزين ، وهي بصمة لمستويات الإجهاد النتروزين من 3-نيتروتيروزين وسينثاز أكسيد النيتريك المستحث وقد ثبت أنه يزداد في خلايا شوان 73 ، 74،75.

وقد أدى اختلال وظائف الميتوكوندريا إلى العديد من مضاعفات مرض السكري. أشارت الدراسات الأولية في الخلايا البطانية المستزرعة إلى أن فرط سكر الدم زاد من التدفق عبر سلسلة نقل الإلكترون ، مما أدى إلى تكوين ROS 76 ، ولكن تم استبدال هذه الملاحظات بأوصاف ضعف نشاط الميتوكوندريا والطاقة الحيوية في مزارع الخلايا العصبية الحسية للبالغين وفي النماذج الحيوانية لمرضى السكري المزمن 77- مرض السكري. لا يبدو أن الميتوكوندريا مصدر لأنواع ROS الزائدة في المحاور الطرفية 79 ، ولكن العديد من النتائج قد حولت التركيز إلى ميتوكوندريا خلية شوان وتأثيرها على وظيفة المحاور. تعرض خلايا شوان لمستويات عالية من الجلوكوز في المختبر يسبب إجهادًا تأكسديًا مصحوبًا بفرط نشاط كاسباس 9 ومنظم موت الخلايا المبرمج BAX ، وانخفاض مستويات منظم موت الخلايا المبرمج Bcl-2 (المرجع 80) ، وهي تغييرات تشير إلى إجهاد داخلي في الميتوكوندريا. في دراسة مهمة نُشرت في عام 2011 ، أثر التعطيل المستهدف لميتوكوندريا خلية شوان في نموذج فأر معدّل وراثيًا بشكل خطير على بقاء الخلايا العصبية وأنتج اعتلالًا عصبيًا محيطيًا مشابهًا لما يسببه مرض السكري 81. أظهر العمل اللاحق أن عجز الميتوكوندريا ينشط استجابة ضغوط غير قابلة للتكيف بوساطة كيناز المثبط المنظم للدم ، وأن الأسيل كارنيتينات التي تم إطلاقها من خلايا شوان على اضطراب الميتوكوندريا تسبب في انحلال محور عصبي 82 ، مما يؤكد أهمية التوازن الخلوي التفاعلي لخلية شوان في محور عصبي. .

وقد ثبت أيضًا أن فرط سكر الدم يؤدي إلى إعادة تشكيل بروتين ميتوكوندريا خلية شوان الذي يؤدي إلى زيادة التعبير عن الوحدات الفرعية α و من سينسيز ATP ، ويسبب قدرة تنفسية دون المستوى الأمثل عن طريق زيادة المعدل الإجمالي لاستهلاك الأكسجين ، مما يشير إلى أن مستويات الجلوكوز العالية تساهم لخلل الميتوكوندريا وتقليل كفاءة الفسفرة المؤكسدة في خلايا شوان 84. في دراسة نُشرت في عام 2016 ، تم وصف تلف الميتوكوندريا ، مع تنظيم وحدات فرعية متعددة من المجمعات الأول والثالث والرابع والخامس والميتوكوندريا Rho GTPase 1 ، في نموذج القوارض لمرض السكري من النوع 1 85. لوحظت هذه التغييرات فقط في الأعصاب الطرفية وليس في العقد الحسية أو الثلاثية التوائم ، مما يشير إلى أنها تعكس التمثيل الغذائي لخلايا شوان المعطلة.

استقلاب الدهون والالتهابات. يرتبط مرض السكري بالتغيرات في مستويات الدهون في الدورة الدموية والأعصاب ، وقد تم ربط خلل خلايا شوان بتغيير التمثيل الغذائي للدهون والعواقب الالتهابية اللاحقة. يبدو أن تراكم الدهون الثلاثية والكوليسترول والأحماض الدهنية الحرة في بلازما الدم في مرض السكري يقود علم الأمراض العصبية بوساطة الدهون عبر آليات غير مفهومة تمامًا ولكنها قد تنطوي على مسارات مؤكسدة والتهابات في خلايا شوان 86. في القوارض ، يتسبب النظام الغذائي الغني بالدهون في تراكم الدهون المؤكسدة وتنشيط إنزيمات الأكسدة الشحمية في الأعصاب المحيطية ، مما يوحي بحالة مقدمات السكري 24. علاوة على ذلك ، فإن تراكم LDL المؤكسد في الأعصاب الطرفية يعزز الإجهاد التأكسدي المرتبط بانخفاض سرعة توصيل الأعصاب والعجز الحسي 87. تشير دراسات زراعة الخلايا إلى أن خلايا شوان معرضة للتسمم الدهني من الأحماض الدهنية الحرة ، ربما نتيجة للخلل الجسيمي 88،89. علاوة على ذلك ، تشير الأدلة من نموذج فأر للاعتلال العصبي المحيطي الثانوي لخلل وظائف الميتوكوندريا في خلية شوان إلى أن اضطراب ميتوكوندريا خلية شوان يؤدي إلى تحول التمثيل الغذائي للدهون بعيدًا عن تخليق الأحماض الدهنية نحو أكسدة الدهون ، مما يؤدي إلى استنفاد مكونات دهون المايلين في وقت مبكر وتراكم دهون الأسيل كارنيتين. المواد الوسيطة ، مما يؤدي إلى تنكس محور عصبي واعتلال عصبي 83. تم العثور أيضًا على اضطراب استقلاب الدهون في الأعصاب المحيطية للفئران المصابة بداء السكري الناجم عن الستربتوزوتوسين (STZ) ، وتشمل هذه الاضطرابات انخفاض في ثلاثي الجلسرين قصير السلسلة ، وتغيرات في الدهون الهيكلية و / أو الغشائية الرئيسية ، وانخفاض مستويات البالمتيك ، الدهني. والأحماض الدهنية eicosanoic 85،90. أدى تعرض خلايا شوان البشرية لمستويات عالية من الجلوكوز خارج الخلية إلى خفض تخليقها للدهون الفسفورية ، وقد تم إبطال هذا التأثير من خلال التهابات الجهاز التنفسي الحادة ، مما أدى إلى ارتفاع معدلات التمثيل الغذائي للجلوكوز عبر مسار البوليول في خلل تنظيم التمثيل الغذائي للدهون في خلية شوان 91.

في مرض السكري ، تتعرض البروتينات الدهنية المنتشرة في البلازما لبيئة مؤكسدة ويمكن تعديلها عن طريق الجلوكوز الناتج عن ذلك. تعبر خلايا شوان عن العديد من المستقبلات الشبيهة بـ Toll (TLRs) و RAGE 92،93 ، والتي يمكن أن ترتبط بها LDLs المعدلة وتؤدي إلى استجابة التهابية 94. بعد الإصابة ، مثل تلك الناجمة عن ارتفاع السكر في الدم أو LDLs المعدلة ، يمكن تنشيط الشلالات داخل الخلايا في خلايا شوان ، بما في ذلك الانتقال النووي لـ NF-B والتعبير اللاحق عن السيتوكينات المختلفة والكيموكينات ، على غرار السيناريو بعد تلف الأعصاب الرضحي. تساهم هذه الأحداث في تنكس والريان وتؤكد على المشاركة المحتملة لخلايا شوان في الالتهاب تحت الإكلينيكي الذي لوحظ في مرضى السكري من النوع 2 ويمكن اكتشافه مع زيادة مستويات الدورة الدموية للبروتين التفاعلي C و IL-6 ، والتي ترتبط باستمرار باعتلال الأعصاب المتعدد 95. علاوة على ذلك ، من خلال إنتاج السيتوكينات والكيموكينات ، قد تساهم خلايا شوان في تجنيد الخلايا المناعية 4،96 والتهاب الأعصاب في مرض السكري.

وقد لوحظ تسلل وانتشار البلاعم في الأعصاب من نماذج الفئران لمرض السكري 97،98 ، كما أن تنظيم الجينات المسببة للالتهابات أثناء تنشيط المسارات الالتهابية في PNS 99،100،101 يشير إلى تورط تورط خلية شوان بوساطة RAGE في الاستجابة الالتهابية. يقوم أحد الجينات المنتظمة بتشفير البروتين المرتبط بالكالسيوم S100 A8 / A9 (المرجع 101) ، والذي يتم التعبير عنه بشكل مفرط في مرضى السكري من النوع 2 102. لقد ثبت أن هذا البروتين يحفز الاستجابة الالتهابية المحلية من خلال التفاعل مع RAGE 103 ، مما يؤدي إلى تنشيط كينازات البروتين المنشط بالميتوجين (MAPKs) و NF-B وموت الخلايا المبرمج 104105. وبالمثل ، يتم تنشيط MAPKs (مثل p38 MAPK و MAPK1 و MAPK3 و MAPK8 و MAPK10) عن طريق مستويات عالية من الجلوكوز في ثقافات خلايا شوان البشرية 106 ص 38 ذات أهمية خاصة ، لأنها منظم سلبي لتمايز خلايا شوان والميالين 107.

تشير بعض الأدلة أيضًا إلى أن خلايا شوان والخلايا التائية لها تأثيرات متبادلة على بعضها البعض في مرض السكري. اقترحت دراسة نُشرت في عام 2013 أن تجنيد الخلايا التائية في أعصاب المرضى الذين يعانون من اعتلال الأعصاب السكري ناتج عن إنتاج الكيماويات CXCL-9 و CXCL-10 و CXCL-11 بواسطة خلايا شوان المحفزة بالجلوكوز 108. على العكس من ذلك ، فقد ثبت أن خلايا CD8 + T المتسللة تتوسط في السمية الخلوية لخلايا شوان عن طريق تنشيط موت الخلايا المبرمج ، وبالتالي المساهمة في تطور الاعتلال العصبي 108. علاوة على ذلك ، نظرًا لأن الخلايا التائية الموجودة في أعصاب مرضى السكري تعبر عن مستويات عالية من CXCR3 ، فإن مؤلفي هذه الدراسة يقترحون أن هذا المستقبل مهم لهجرة خلايا CD8 + T إلى العصب المحيطي ، وبالتالي ، يقدم هدفًا محتملاً جديدًا للعلاج.

العوامل الإضافية في مرض السكري التي تعزز تسلل الخلايا المناعية للأعصاب وتنشيط خلايا شوان هي تراكم AGE وتعديل مستضدات المايلين عن طريق الارتباط بالجليكوزيل لبروتينات المايلين. يؤدي تنشيط خلايا شوان بدوره إلى تعزيز إفراز السيتوكينات المنشطة للالتهابات ، مما ينتج عنه آلية ردود فعل إيجابية تديم الإصابة 109،110. يمكن إنتاج السيتوكينات الالتهابية مثل IL-1 وعامل نخر الورم (TNF) و IL-17 عن طريق العديد من أنواع الخلايا ، بما في ذلك خلايا شوان ، وهذه العوامل تعمل على توعية الألياف Aδ والألياف C ، مما يؤدي إلى ألم الأعصاب 111،112،113. في الواقع ، لقد ثبت أن منع مسار إشارات TNF باستخدام بروتين اندماج مستقبل عامل TNF البشري المؤتلف مع جسم مضاد مفيد في النماذج الحيوانية للاعتلال العصبي السكري ، مما يؤدي إلى استعادة سرعة التوصيل العصبي وزيادة التعبير عن بروتين المايلين الأساسي 109.

تعبر خلايا شوان في العصب المحيطي عن مجموعة متنوعة من المستقبلات TLRs ، بما في ذلك TLR4 (المرجع 92) ، والتي قد يكون لها دور في التسبب في ضعف الشبكية الناجم عن التمثيل الغذائي واعتلال الكلية 114،115. ومع ذلك ، لا يزال يتعين توضيح ما إذا كان TLR4 في خلايا شوان له دور في الاعتلال العصبي السكري. ومن المثير للاهتمام ، أنه تم إثبات وجود علاقة متبادلة بين مستقبل TLR4 ومستقبل p75NTR في الخلايا المناعية. في الخلايا التغصنية المحفزة بعديد السكاريد الدهني ، تمت زيادة التعبير عن p75NTR عبر آلية تعتمد على TLR4. في الخلايا التغصنية التي يتم تنشيطها بواسطة TLR4 ، يعزز NGF إفراز السيتوكينات ، لكن إسكات p75NTR باستخدام RNA صغير متداخل يمنع هذه العملية. تشير هذه الملاحظات إلى أن زيادة التعبير عن p75NTR في أغلفة المايلين حول الألياف المعرضة لتنكس محور عصبي في الاعتلال العصبي السكري 117 قد يكون مرتبطًا بإشارات TLR4.

تغيرات الأوعية الدموية الدقيقة وخلايا شوان. من المحتمل أن يؤثر تلف الأوعية الدموية الدقيقة في اعتلال الأعصاب السكري على وظيفة خلايا شوان من خلال تعزيز الشلالات الالتهابية مثل تلك المذكورة أعلاه ، وعن طريق تعطيل وصولهم إلى الأكسجين والجلوكوز. يتم تغيير شكل ووظيفة الأوعية الدقيقة في عينات خزعة الأعصاب من مرضى الاعتلال العصبي السكري. علاوة على ذلك ، يمكن أن يسبق اعتلال الأوعية الدقيقة تطور الاعتلال العصبي السكري 120،121 ، ودرجة تغيرات الأوعية الدموية الدقيقة ترتبط بالحدة السريرية للاعتلال العصبي السكري 119،120.

يُعتقد أن تغيرات الأوعية الدموية الدقيقة تؤدي إلى تلف الأعصاب عن طريق الحد من إمداد الدم بالأعصاب (نقص التروية) ، ولكن الأدلة تظهر الآن أن نقص الأكسجة داخل العصب يمكن أن يكون ناتجًا عن الاستخراج غير الفعال للأكسجين وحده عن طريق الخلل الوظيفي في الشعيرات الدموية. يمكن لنقص الأكسجة في الأنسجة ، بدوره ، تنشيط نفس مسارات الإشارات الخلوية التي ينشطها الالتهاب. يمكن تنشيط هذه المسارات في جميع أنواع الخلايا التي تتعرض لنقص الأكسجة ، بما في ذلك خلايا شوان. يعمل توتر الأكسجين المنخفض في الأنسجة على تنظيم التعبير عن العامل المحرض بنقص الأكسجة 1-α (HIF-1α) و NF-κB 123 ، وهو عامل النسخ المسبِّب للالتهاب الموجود عند مستويات عالية في الأعصاب الطرفية وعقد الجذر الظهرية في الاعتلال العصبي السكري التجريبي 124. يتسبب HIF-1α في زيادة مستويات NADPH oxidase 2 125 ، وهو مصدر رئيسي لـ ROS في جدران الوعاء. تتفاعل الأكاسيد الفائقة المشتقة من NADPH مع أكسيد النيتريك الموسع للأوعية لإنتاج البيروكسينيتريت 127 ، الذي يسبب تلفًا شديدًا في الأنسجة النيتروجينية ويعطل منشط البلازمينوجين النسيجي (tPA) 128 ، مما يخلق بيئة شديدة التجلط. الأهم من ذلك ، أن المستويات المرتفعة من tPA تزيد من تكوين BDNF من proBDNF ، ويرتبط proBDNF مع موت الخلايا المبرمج 129 هذه الملاحظة تتوافق مع التقارير التي تفيد بأن مستويات BDNF في العضلات البعيدة ترتبط سلبًا مع شدة الاعتلال العصبي لدى مرضى السكري 130. تشير هذه الآليات إلى أن تغيرات الأوعية الدموية الدقيقة من المحتمل أن تخلق بيئة داخلية ناقصة التأكسج تؤدي إلى تفاقم الإجهاد التأكسدي والالتهاب ، وتؤدي إلى فقدان الدعم الغذائي لخلايا شوان والخلايا العصبية.

يؤثر الخلل الوظيفي الشعري على امتصاص الجلوكوز والأكسجين في الأنسجة 131 ، ويؤدي انهيار الجلوكوز في ظل ظروف نقص الأكسجة إلى إنتاج ATP أقل بكثير من الفسفرة المؤكسدة. عندما يكون الوصول إلى الأكسجين ضعيفًا ، فمن المحتمل أن تعتمد خلايا شوان والمحاور على ركائز بديلة أو مسارات التمثيل الغذائي لتغطية احتياجاتها الأيضية. يعد انهيار الجلوكوز عبر مسار البوليول - على الرغم من آثاره الضارة طويلة المدى - مصدرًا فعالًا لـ ATP في هذه الظروف. نتيجة لذلك ، يمكن أن تكون مثبطات اختزال الألدوز ضارة بالألياف العصبية ذات الأوعية الدقيقة المتأثرة بشدة ، لأنها ستحد من هذا المصدر البديل للطاقة 122.

تشير الأدلة التي تمت مناقشتها إلى أنه في اعتلال الأعصاب السكري ، يعطل الخلل الوظيفي الشعري وظيفة خلايا شوان والمحاور - والعكس بالعكس - عن طريق تغيير البيئة الدقيقة داخل العصب. في ضوء هذه الفرضية ، فإن إنشاء نماذج حيوانية لمرض السكري تتضمن تلف الأوعية الدموية الدقيقة 46 ، أو استخدام أنظمة زراعة الخلايا التي تحاكي البيئة الدقيقة داخل البول السكري ، قد يزيد من نجاح البحث المترجم.

الاضطراب العقدي والقنوات الأيونية. يعني الارتباط الوثيق بين خلايا شوان والمحاور العصبية أن الاضطرابات في وظيفة خلية شوان من المحتمل أن تؤثر على استثارة الألياف الكبيرة والصغيرة وانتشار إمكانات الفعل. يتم التوسط في إمكانات غشاء الراحة وإزالة الاستقطاب وإعادة استقطاب المحاور بواسطة سلسلة من الصوديوم ذي الجهد الكهربي (Na).الخامس) قنوات البوتاسيوم (K.الخامس) قنوات وقنوات الكالسيوم وقنوات مختلفة ذات بوابات (على سبيل المثال ، قنوات محتملة لمستقبلات عابرة) 132. In myelinated axons, the ion channels are clustered at the nodes of Ranvier to facilitate saltatory conduction, whereas in nonmyelinated axons, the channels are distributed diffusely and almost homogeneously along the axon 133,134 . Schwann cells are not excitable themselves, but do express ion channels that are involved in forming the nodal and paranodal regions where the neuronal ion channels are clustered, giving them the potential to influence axonal excitability.

The effects of Schwann cell dysfunction on neuronal ion channel function are not known and may be indirect. Impaired mitochondrial function and oxidative stress in Schwann cells (see above) could lead to changes in the distribution of Naالخامس وكالخامس channels at the nodes of Ranvier and the paranodal and juxataparanodal regions, contributing to axonal damage. Mitochondrial dysfunction may also be a consequence of increased intracellular calcium 135 . A detailed discussion of the role of ion channels in diabetic neuropathy is beyond the scope of this Review, but abnormalities such as paranodal swelling and axon–glial disjunction have been described in diabetic neuropathy in humans, and were proposed as a cause of nodal ion channel redistribution 136 . ناالخامس channel expression in diabetes can be modified by various mechanisms, including neurotrophic factors 137 and methylglyoxal, a metabolite that is upregulated as a result of hyperglycaemia, and has been shown to change the distribution of Naالخامس1.8 (Ref. 138). Together with changes in ion channel function and energy metabolism in the axon itself, such as impaired Na + –K + ATPase activity in nodal regions of the axon, Schwann cell dysfunction could — owing to the normal function of these cells in saltatory conduction — contribute to the reduction in action potential propagation seen in diabetic neuropathy. In a study published in 2016, mathematical modelling was used to provide evidence that abnormalities in the excitability of sensory and motor axons in patients with type 1 diabetes were the result of reduced nodal Na + currents, reduced nodal and paranodal K + conductance, and Na + –K + ATPase dysfunction 139 . Evidence also suggests that altered expression of Naالخامس channels, specifically Naالخامس1.7 ، ناالخامس1.8 and Naالخامس1.9, contributes to the neuronal hyperexcitability and allodynia seen in experimental and clinical diabetic neuropathy 52,53,54,55 .

Box 3: Satellite glial cells

Diabetic neuropathy is generally considered to be a length-dependent phenomenon, meaning that the longest nerve fibres are most at risk, with the most severe damage occurring in the terminal regions of long axons, but with other regions of the neuraxis also affected. For example, in the dorsal root ganglia, neuronal cell bodies are individually surrounded by satellite glial cells that, together with a thin layer of connective tissue, form an envelope around the neurons 16 , and evidence over the past decade has established that satellite cells are important components of PNS functionality and post-injury responses, such as pain and nerve regeneration 191,192 . Like Schwann cells, satellite cells express aldose reductase 39 , and the effect of diabetes on this enzyme leads to altered expression of several proteins in these cells 193,194 . In rodent models of both type 1 and type 2 diabetes, expression of glial fibrillary acidic protein is increased in satellite glial cells that surround sensory neurons this increased expression has been proposed to be a reflection of satellite cell activation, which has been implicated in the genesis of neuropathic pain 195,196 . However, the biology and function of these cells during diabetes is essentially unexplored, and warrants further investigation.


(p. 573) Peripheral Neuropathy and the Schwann Cell

PRINTED FROM OXFORD MEDICINE ONLINE (www.oxfordmedicine.com). © Oxford University Press, 2021. All Rights Reserved. Under the terms of the licence agreement, an individual user may print out a PDF of a single chapter of a title in Oxford Medicine Online for personal use (for details see Privacy Policy and Legal Notice).

The Schwann cell (SC) is the sole source of myelin for peripheral nerves. During axon growth in development, SC precursors proliferate and migrate to the axon, establishing a 1:1 myelinating relationship with a larger-diameter axon or ensheathing a number of smaller axons. Schwann cells are also responsible for determining the structural organization of the node of Ranvier as well as for mediating the spacing and clustering of sodium channels in the axonal membrane and the separation of sodium from potassium channels. This chapter highlights the dependence of peripheral nerve function on SCs and presents evidence that alterations in SC protein expression and viability are responsible, in part, for diverse peripheral neuropathies.

يتطلب الوصول إلى المحتوى الكامل على موقع Oxford Medicine Online اشتراكًا أو شراءًا. يمكن للمستخدمين العموميين البحث في الموقع وعرض ملخصات كل كتاب وفصل بدون اشتراك.

يرجى الاشتراك أو تسجيل الدخول للوصول إلى محتوى النص الكامل.

إذا كنت قد اشتريت عنوانًا مطبوعًا يحتوي على رمز وصول ، فيرجى الاطلاع على الرمز المميز للحصول على معلومات حول كيفية تسجيل الرمز الخاص بك.

للأسئلة حول الوصول أو استكشاف الأخطاء وإصلاحها ، يرجى مراجعة الأسئلة الشائعة ، وإذا لم تتمكن من العثور على الإجابة هناك ، فيرجى الاتصال بنا.


المواد والأساليب

Animals and genotyping

All surgical procedures and animal maintenance complied with the National Institute of Health guidelines regarding the care and use of experimental animals and were approved by the Institutional Animal Care and Use Committee of Temple University, Philadelphia, PA, USA. All mice were of either sex, and were on the C57/Bl6 background. Generation of mice carrying targeted loxP sites in the Yap و Taz genes and the genotyping of these mice have been described previously (Xin et al., 2013) (MGI:5446483 and MGI:5544289). Targeted ablation of Yap و Taz in Schwann cells of embryonic mice was achieved by crossing Yap fl/fl , Taz fl/fl or Yap fl/fl Taz fl/fl mice with mice heterozygous for Yap and/ or Taz and transgenic for Cre driven by the P0 promoter (Feltri et al., 1999) (MGI:2450448). Targeted ablation of Yap و Taz in Schwann cells of adult mice was by doing the above crosses of Yap fl/fl and Taz fl/fl mice with mice transgenic for the inducible Cre recombinase Cre-ERT2 under control of either the Plp1 promoter (Pereira et al., 2009) (MGI:2663093) or the Sox10 المروجين. ال Sox10-CreERT2 BAC Tg mice were generated with the homologous recombination method (Yang et al., 1997) (MGI:5634390) by Dr. Shin Kang at Temple University. Control mice contained floxed Yap and/or Taz alleles but were not transgenic for Cre. Genotyping of Plp1-CreERT2 mice used Plp1-Cre primers (Pereira et al., 2009) and of Sox10-CreERT2 mice used the following primers: CACCTAGGGTCTGGCATGTG and ATCGCGAACATCTTCAGG.

Tamoxifen administration

Tamoxifen or 4-hydroxy tamoxifen (4-HT Sigma, St. Louis, MO) was injected into 6–8 week old iDKO mice. Tamoxifen was prepared and injected intraperitoneally (i.p.) at 0.2 mg/g body weight/d, as described (Grove and Brophy, 2014). A 20 mg/ ml stock of 4-hydroxy tamoxifen (4-HT) in 100% ethanol was prepared by sonication, and a 1 mg aliquot mixed 1:5 with sunflower oil. After evaporation of the ethanol by speedvac, 1 mg of 4-HT in sunflower oil was injected i.p. twice daily for three days, followed by once daily for two days. Five days later, mice were injected i.p. once daily for five consecutive days.

Western blotting and immunoprecipitation

For Western blotting and immunoprecipitation, epineurium and perineurium were removed from sciatic nerves, which were then snap-frozen in liquid nitrogen and stored at −80°C. For Western blotting, sciatic nerves were lysed in RIPA buffer (25 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 1 mM EDTA, 0.1% SDS), and for immunoprecipitation, lysis was in co-IP buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.5% Triton X-100, 10% glycerol, 1 mM EDTA), both containing protease and phosphatase inhibitors. Lysis was for 40 min on ice, followed by microcentrifugation at 14,000 rpm for 20 min. Protein concentration was determined using the BCA assay (Thermo Fisher, Waltham, MA).

Immunoprecipitation was overnight at 4°C, followed by 1 hr with protein A sepharose (pre-blocked with 1% BSA), both with constant rotation. Lysates and immunoprecipitated complexes in 1x Laemmli buffer were resolved on 8 or 10% SDS-PAGE gels, transferred to nitrocellulose and blotted with the appropriate antibodies. Primary antibodies were used at the following concentrations for Western blots or (if indicated) immunoprecipitations: rabbit anti-Krox20 (Covance, San Diego, CA 1:400), rabbit anti-Oct6 (Abcam, United Kingdom, ab126746 1:1000), mouse anti-Myelin Basic Protein (Covance SMI94 1:1000), mouse anti-beta actin (SIGMA-Aldrich A5441 1:5000), rabbit anti-Sox10 (Abcam ab155279 1:20,000), rabbit anti-TEAD1 (Cell Signaling, Danvers, MA, D9 × 2L, #12292 1:1000 1:100 for immunoprecipitation), rabbit anti-TEAD3 (Cell Signaling #13224 1:1000 1:100 for immunoprecipitation), rabbit anti-pan-TEAD (Cell Signaling D3F7L, #13295 1:1000 1:100 for immunoprecipitation), rabbit anti-YAP/TAZ (Cell Signaling D24E4, #8418 1:1000), rabbit anti-phospho-YAP (Cell Signaling D9W2I #13008 1:1000), mouse anti-YAP1 (Abcam ab56701 1: 400), rabbit anti-NFAT3 (Cell Signaling 23E6, #2183 1:1000), rabbit anti-NFAT4 (Cell Signaling #4998 1:1000), rabbit anti-YY1 (Abcam ab12132 1:500). Control whole rabbit IgG for immunoprecipitations was from Jackson Laboratories (Bar Harbor, ME, 011-000-003) and was used at 1 μg/ml, which was several-fold excess over all antibodies used for immunoprecipitations. Secondary antibodies for Westerns were HRP-linked sheep anti-mouse IgG and donkey anti-rabbit (both GE Healthcare, United Kingdom 1:5000) and HRP-linked mouse anti-rabbit, light-chain specific (Jackson ImmunoResearch, West Grove, PA, 211-032-171 1:20,000). Blots were developed using ECL, ECL Plus (GE Healthcare) or Odyssey (LiCor).

Immunohistochemistry, confocal and widefield fluorescence microscopy

For immunostaining, sciatic nerves were removed and immediately fixed in 4% paraformaldehyde (Pfa)/phosphate buffer for 1 hr. The method for preparation of 7 μm cryosections, and for immunostaining of longitudinal and transverse sciatic nerve sections was as previously described (Grove et al., 2007), except that blocking was in 2% BSA/ PBS rather than fish gelatin. For teased fiber preparation, epineurium was removed from fixed sciatic nerves, before teasing of fibers as described (Sherman et al., 2012). For whole mount immunostaining of extensor digitorum longus (EDL) and soleus muscles, mice were perfused with 4% Pfa/ PBS, muscle removed, then post-fixed for 20 mins at room temperature. Processing and immunostaining of muscle fibers was as previously described (Son and Thompson, 1995). Axons and nerve terminals were labeled with anti-neurofilament and anti-SV2, respectively, while Schwann cells in muscles were labeled with anti-S100 plus anti-p75, in order to detect both intact and denervated Schwann cells. Acetylcholine receptors in muscle were detected using Alexa 647-conjugated a-bungaratoxin (Molecular Probes, Eugene, OR, B35450).

Schwann cells in sciatic nerve cryosections and teased fibers were identified by immunostaining with anti-Sox10. For comparison of total Schwann cell numbers (that is, total Sox10+ nuclei) in sciatic nerves of different genotypes, transverse sections were taken from proximal-, mid- and distal regions of the tibial nerve (three sections per region nine total), and average Schwann cell number per cross-section was calculated. For calculation of the fraction of Schwann cells expressing a particular protein, longitudinal sections were used, and the fraction of Sox10+ cells expressing that protein was averaged over three sections.

Primary antibodies were used at the following concentrations for immunostaining of cryosections: guinea pig anti-Sox10 (kind gift from Michael Wegner, University of Erlangen, Bavaria, Germany 1:1000), rabbit anti-Krox20 (Covance 1:400), rabbit anti-Oct6 (Abcam ab31766 1:800), rabbit anti-Ki67 (Novocastra NCL-Ki67p 1:200), rabbit anti-Neurofilament 200 (SIGMA-Aldrich N4142 1:500), mouse anti-Neurofilament (Covance SMI 312 1:1000), mouse anti-SV2 (Developmental Studies Hybridoma Bank, Iowa 1:10), rabbit anti-S100 (DAKO 1:600), mouse anti-Myelin Basic Protein (Covance SMI 94 1:2000), goat anti-p75 (Neuromics, Minneapolis, MN, GT15057 1:500), rabbit anti-TEAD1 (Cell Signaling D9 × 2L, #12292 1:200), rabbit anti-pan-TEAD (Cell Signaling D3F7L, #13295 1:200), rabbit anti-YAP/TAZ (Cell Signaling D24E4, #8418 1:200), rabbit anti-phospho-YAP (Cell Signaling D9W2I #13008 1:200), mouse anti-YAP1 (Abcam ab56701 1: 200), mouse anti-GFAP (SIGMA-Aldrich G3893 1:500), rabbit anti-cleaved caspase 3 (Cell Signaling #9661 1:400), anti-CC1. Conventional fluorescence microscopy was performed using Olympus BX53 and Zeiss Axio Imager two microscopes. Images were captured using Hamamatsu ORCA R2 C10600 or Zeiss Axiocam HRm Rev three digital cameras, respectively, and Metamorph software. For confocal microscopy, we used a Leica SP8 confocal microscope, with either a 40 × 1.3 NA or 63 × 1.4 NA objective and Leica proprietary software. Acquired stacks were assembled using the maximum projection tool, and figures were prepared using Adobe Photoshop.

Electron microscopy, histology and morphometry

Mice were perfused intravascularly with 2.5% glutaraldehyde and 4% paraformaldehyde in 0.1M cacodylate buffer pH 7.4. Sciatic nerves and nerve roots were removed and incubated in the same buffer for 90 min at room temperature then overnight at 4°C, with rotation. Specimens were post-fixed for 1 hr with OsO4, dehydrated then embedded in araldite. Semi-thin (0.5 μm) and ultrathin (70 nm) section were cut using an ultramicrotome, and stained with toluidine blue or uranyl acetate and lead citrate, respectively. Semi-thin sections were examined using bright-field on an Olympus BX53 microscope, and images captured using Hamamatsu ORCA R2 C10600 digital camera and Metamorph software.

For analysis of the number of myelin profiles in control vs mutant sciatic nerves, semi-thin sections from proximal-, mid- and distal regions of the sciatic nerve were taken, and two non- overlapping images of each section were taken using the 60x objective: these images were termed ‘field of view’ (FOV). The average number of myelin profiles in each FOV was calculated, using ImageJ software. For electron microscopy, stained ultrathin sections were examined using a JEOL 1010 electron microscope fitted with a Hamamatsu digital camera and AMT Advantage image capture software.

TUNEL and proliferation assays

The percentage of Schwann cells in S-phase at E17.5 and P4 was measured by EdU incorporation. Timed pregnant females and P4 pups were respectively injected intraperitoneally and subcutaneously with 80 μg/ g body weight of EdU dissolved in PBS. Eighty minutes later, E17.5 embryos and P4 pups were sacrificed, and sciatic nerves removed and fixed for 1 hr in 4% Pfa longitudinal 7 μm cryosections were used for analysis. EdU incorporation was identified using the Click-iT EdU Alexa Fluor 555 labeling kit (Molecular Probes) the recommended protocol was followed, and labeling was for 1 hr. After EdU labeling, sections were immunostained with anti-Sox10 to identify Schwann cells (notably, many proliferating cells in the sciatic nerves were not Schwann cells). The percentage of Schwann cells (Sox10+ nuclei) that were EdU+ was determined by counting of confocal images using ImageJ software. The Promega Deadend TUNEL assay kit was used to investigate Schwann cell apoptosis in longitudinal and transverse 7 μm cryosections. The recommended protocol was followed, with the following modification: after rehydration in PBS, sections were treated with L.A.B. retrieval solution for 5 min (Polysciences, Inc 24310–500), then washed 3x in PBS, prior to permeabilization in 0.2% Triton-X-100 for 10’, as per the recommended protocol. As a positive control, sections were treated with 7.5 U/ml DNase1 for 10’ prior to the TUNEL assay as a negative control, TdT enzyme was omitted from the assay. After the TUNEL assay, sections were immunostained with anti-Sox10 to identify Schwann cells, and TUNEL+ Schwann cells in confocal images were counted using ImageJ software.

Real-time quantitative RT-PCR

Sciatic nerves were removed from P60 control and cDKO mice, and total RNA extracted using an RNeasy Lipid Tissue Mini Kit (Qiagen). RT-qPCR was performed using the Power SYBR Green RNA-to-CT one-step kit (Applied Biosystems), specific primers, plus 20 ng RNA per reaction. β-أكتين was used as an endogenous reference gene, and relative expression of Krox20 in control and cDKO samples was calculated according to the Comparative Ct method (Livak and Schmittgen, 2001), using StepOne Software (V 2.3). Primer sets used were as follows: 5’-AGGCCCCTTTGACCAGATGA-3’ and 5’-AAGATGCCCGCACTCACAAT-3’ for Krox20 (Bremer et al., 2011) 5’-CTCCCCGAAGTTCTTCCCAT-3’ and 5’TAAGGTTGCTGTTACAGACATTG-3’ for ITGA6 5’-ACCCTAAGGCCAACCGTGA-3’ and 5’-ATGGCGTGAGGGAGAGCATA-3’ for β-أكتين 5’-GACATCTTCTGGTCAAAGATACTTC-3’ and 5’-GCAGGAACGTTCAGTTGCG-3’ for Yap 5’-GTCCATCACTTCCACCTCGG-3’ and 5’-CGACTTGCTGGTGTTGGTGA-3’ for Taz. Samples were run in triplicate, and experiments performed three times.

ChIP assay

ChIP assays were done using eight sciatic nerves from P12-P15 wild-type mice per immunoprecipitation, using a modified version of a published protocol (Pal et al., 2004). Sciatic nerves were collected in PBS on ice. The PBS was replaced by PBS/1% formaldehyde containing protease inhibitors, and nerves were rapidly diced using scissors. Nerves were crosslinked for 10’ with rotation at room temperature, washed with PBS/0.15M glycine for 5’ with rotation at room temperature, then washed 3x with ice-cold PBS. Nerves were lysed using ChIP lysis buffer (50 mM Tris pH 8.1, 100 mM NaCl, 5 mM EDTA, 0.5% SDS plus protease inhibitors) for 30’ at 4°C, then pelleted by microfugation at 14K for 15’. Supernatant was removed, and pellets were resuspended in 1 ml of ChIP IP buffer (50 mM Tris pH 8.6, 0.3% SDS, 1.7% Triton X-100, 5 mM EDTA plus protease inhibitors). Chromatin was sheared in an ice water bath by sonication using a Fisher Scientific FB120 sonic dismembrator set at 75% amplitude, with 10 cycles of 10’’ on/50” off. After shearing, chromatin was clarified by microcentrifugation at 14K for 20 min, snap-frozen in liquid nitrogen and stored at −80°C. 1 ml aliquots of chromatin were pre-cleared using pre-blocked PAS (Millipore 16–157), then 50 μl removed and stored as ‘input’ chromatin. The remaining chromatin was immunoprecipitated overnight with 0.4 μg rabbit anti-TEAD1 (Cell Signaling #12292), 4 μg rabbit anti-TAZ (Cell Signaling #4883) and 0.5 μg or 5 μg of whole rabbit IgG, respectively (Jackson Laboratories 011-000-003). Immune complexes were collected using pre-blocked PAS (for 2 hr, then washed x2 sequentially with: low salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris pH 8.0) high salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl, 20 mM Tris pH 8.0) LiCl buffer (1% NP40, 1% Na deoxycholate, 1 mM EDTA, 250 mM LiCl, 10 mM Tris pH 8.0) TE (10 mM Tris, 1 mM EDTA, pH 8.0), all containing protease inhibitors. After the final TE wash, chromatin was eluted from the beads 2x for 20’ with gentle vortexing in 150 μl Elution buffer (1% SDS, 0.1M NaHC03) at room temperature. 0.2M NaCl was added, and chromatin de-crosslinked overnight at 65°C. Samples were treated with RNase A (0.3 mg/ml) at 37°C for 1 hr, then proteinase K (0.6 mg/ml) at 55°C for 1 hr, before purification of immunoprecipitated chromatin using QIAquick columns (Qiagen). Chromatin was eluted in 25 μl 10 mM Tris pH 8.0, and stored at −20°C. qPCR reactions were in 10 μl, using Power SYBR green PCR mastermix (Applied Biosystems # 4367659), 4 μl of sample (1:80 dilution of input and 1:20 dilution of IPs) and the following primers: Krox20 MSE : E1 forward: CCTCTCCGGGGTTGGACTA E1 reverse: GGGCCACCCACAGTTACCTT E2 forward: GGCCCTCCATTTATTTCCCTG E2 reverse: TGCTGGAAACGAAACAACAAACT E3 forward: TGTGACAAACCCATCTCGCA E3 reverse: TCAGCTTTGTGAAGGGCTCA E4 forward: CGGACTTGCATTGCACAGAA E4 reverse: CCCGTACATCCACTCACACA E5 forward: CCTTCACAAAGCTGAAATCCTG E5 reverse: CATTTCGTCTTTGGGCTCAT E6 forward: CATGGTTAGGAGGAACAAACTG E6 reverse: CTATCTCAACCTGCCAATCCA. Negative Controls : Miro1 forward 1: GCAATTTCTTGGGCTGTGATATAG Miro1 reverse 1: GCTCTTAGAGGCACTTTGGAT β-أكتين forward: GGCTGTATTCCCCTCCATCG β-أكتين reverse: CGTCCCAGTTGGTAACAATGCC MBP forward 1: TCTGAGCAAATGCTTCTAAGCTG MBP reverse 1: CTAGAGCAGAAAGTGAGCTTCC.

الفيزيولوجيا الكهربية

The procedure for measuring nerve conduction velocity was an adaption of a previously used protocol (Schulz et al., 2014). Mice were deeply anaesthetized, and hair completely removed from the hindquarters. A 27g percutaneous needle electrode was inserted subcutaneously over the femur to stimulate the sciatic nerve at two locations: one proximal to the spinal cord, at the hip joint, and the other 1 cm distal to this site. The stimulation reference electrode (26G percutaneous needle) was inserted over the back. Bipolar EMG electrodes were inserted subcutaneously in the digital interosseous muscles, to record compound action potentials in response to activation of the sciatic nerve. Stimulation and recording were conducted on both hindlimbs. The muscle response was first tested with single pulses (100 μs duration) to determine the threshold and level of activation producing a stable compound action potential in the muscle. The level of stimulation which produced stable responses was then used for two series of stimulations with 2–20 s long trains of biphasic square wave pulses (100 μs duration) delivered at 1–5 Hz. The nerve was rested for 2 min between runs. Stimulation was delivered via an isolated pulse stimulator (A-M Systems Model 2100, A-M Systems Inc, Carlsborg, WA). EMG compound muscle action potential (CMAP) responses were recorded with a differential AC amplifier (A-M Systems Model 1700 gain 1 k– 10 k pass band 10–50 KHz). Data was sampled at 50 KHz using LabVIEW (National Instruments Corporation, Austin, TX) running on a personal computer. Multiple recordings were taken at each location to ensure a minimum of 10 quality responses for each location and animal. Electrophysiological data was analyzed using Igor Pro (Wavemetrics Inc, Lake Oswego, OR).

Behavioral tests

Foot printing gait analysis: Mouse paws were dipped in non-toxic water-based paints: forepaws: pink hindpaws: blue. Mice were then allowed to walk along an 80 cm x 10 cm white paper runway. Grip strength test: Mice were allowed to grip the grid of a BIO-GS3 grip strength testing device (Biosep, France), using both fore- and hindpaws, then were gently pulled by the tail, parallel to the grid. The maximum force prior to the release of all of the mouse’s paws from the grid was recorded. This was repeated with forepaws alone, and grip strength of hindpaws was calculated by subtraction of the forepaw measurement from the total grip strength measurement. The apparatus was cleaned using alcohol between trials. Temperature preference/ aversion test: Two-choice temperature preference/ aversion assays were used to determine hot and cold thermal thresholds, using methods essentially, as described (Fisher et al., 2015). Briefly, mice were placed in a Plexiglass chamber containing a reference plate fixed at 25°C plus an adjacent variable temperature test plate (Bio-T2CT, BioSeb, France). Mice were allowed to habituate to the chamber for 3 min with both plates at 25°C, then the test plate temperature was increased to 49°C or decreased to 10°C in 3°C increments, at 3 min intervals. Movement of mice between reference and test plates was recorded using a video tracking system, and percentage of time at each temperature calculated. Preference/ aversion to cold vs hot temperatures was assayed on separate days.

تحليل البيانات

In each experiment, data collection and analysis was performed identically, regardless of mouse genotype. Data is presented as mean +/- SEM. Statistical analysis was done using unpaired Student’s t-test or 2-way ANOVA with either Sidak’s or Tukey’s multiple comparison tests, according to the number of samples and the analysis of mice at multiple ages. Sample sizes were similar to those employed in the field and are indicated in main text, methods or figure legends. Data distribution was assumed to be Gaussian, but was not formally tested, and p<0.05 was considered significant.

P values, differences between means (DM), 95% confidence intervals (CI) of differences between mean, t-distributions and degrees of freedom (df) were as follows: Figure 2 (G): unpaired Student’s t-test. Yap/Taz cDKO myelinating Schwann cells per FOV, p=0.0034, DM = −358.7 + /−54.54, CI = −518.4 to −198.9, t = 6.233, df = 4. Figure 3C: 2-way ANOVA, with Sidak’s multiple comparison test. Taz cKO/Yap cHET and Yap/Taz cDKO myelinating and promyelinating Schwann cells per FOV, Taz-cKO/Yap-cHET P18: promyelinating, p=0.0002, DM = −144.0, CI = −208.2 to −79.82, t = 6.306, df = 11 P18 myelinating, p<0.0001, DM = 667.8, CI = 541.3 to 794.4, t = 14.83, df = 11 P60 promyelinating: p>0.9999, DM = 0, CI = −71.76 to+71.76, t = 0, df = 11 P60 myelinating: p=0.2271, DM = 96.25, CI = −45.25 to 237.8, t = 1.912, df = 11. YAP/TAZ-cDKO, P18 promyelinating: p=0.0569, DM = −62.5, CI = −126.7 to 1.68, t = 2.737, df = 11 P18 myelinating: p<0.0001, DM = 778.7, CI = 652.1 to 905.2, t = 17.29, df = 11 P60 promyelinating: p<0.0001, DM = −210.3, CI = −274.5 to −146.2, t = 9.211, df = 11 P60 myelinating: p<0.0001, DM = 377, CI = 250.4 to 503.6, t = 8.372, df = 11. Figure 4: (A-C) 2-way ANOVA, with Sidak’s multiple comparison test. (أ) Yap/Taz cDKO total Sox10+ Schwann cells per sciatic nerve, E17.5: p=0.3244, DM = 35.67, CI = −18.57 to 89.9, t = 1.887, df = 18 P0: p=0.0009, DM = 98.95, CI = 38.31 to 159.6, t = 4.682, df = 18 P4: p<0.0001, DM = 224.2, CI = 169.9 to 278.4, t = 11.86, df = 18 P18: p=0.0008, DM = 100.5, CI = 39.86 to 161.1, t = 4.755, df = 18 P60: p<0.0001, DM = 116.2, CI = 61.96 to 170.4, t = 6.147, df = 18. (B) Yap/Taz cDKO Ki67+ Schwann cells, P0: p=0.0025, DM = 11, CI = 3.733 to 18.27, t = 4.244, df = 16 P4: p=0.9235, DM = −1.9, CI = −9.167 to 5.367, t = 0.7331, df = 16 P18: p=0.3356, DM = −4.567, CI = −11.83 to 2.7, t = 1.762, df = 16 P60: p=0.9995, DM = −0.5, CI = −7.767 to 6.767, t = 0.1929, df = 16. (C) Yap/Taz cDKO EdU+ Schwann cells, E17.5: p=0.0192, DM = 15.03, CI = 3.133 to 26.93, t = 3.738, df = 6 P4: p=0.8322, DM = −2.8, CI = −17.38 to 11.78, t = 0.5684, df = 6. (D) Unpaired t-test. Yap/Taz cDKO, YAP/TAZ+ vs YAP/TAZ- EdU+ Schwann cells at P4, p=0.0044, DM = −14.73 + /- 0.9772, CI = −18.93 to −10.53, t = 15.07, df = 2. Figure 5: (C, D) 2-way ANOVA, with Sidak’s multiple comparison test. (ج) Yap/Taz cDKO Oct6+ Schwann cells in sciatic nerve, P0: p=0.0027, DM = −29.24, CI = −48.94 to −9.545, t = 4.106, df = 18 P4: p=0.0001, DM = −30.68, CI = −45.93 to −15.42, t = 5.56, df = 18 P18: p<0.0001, DM = −55.26, CI = −88.79 to −53.55, t = 9.272, df = 18 P60: p<0.0001, DM = −71.17, CI = −88.79 to −53.55, t = 11.17, df = 18. (D) Yap/Taz cDKO Krox20+ Schwann cells in sciatic nerve, P0: p=0.1146, DM = 15.13, CI = −2.908 to 33.17, t = 2.491, df = 11 P4: p<0.0001, DM = 44.62, CI = 26.58 to 62.65, t = 7.347, df = 11 P18: p<0.0001, DM = 56.06, CI = 38.02 to 74.1, t = 9.231, df = 11 P60: p<0.0001, DM = 48.35, CI = 28.59 to 68.11, t = 7.268, df = 11. (F) Unpaired t-test. Yap/Taz cDKO, Krox20 mRNA in Schwann cells at P60. p=0.0213, DM = −0.695 + /- 0.1031, CI = −1.139 to −0.2515, t = 6.742, df = 2. Figure 6: (C) Unpaired t-test. Nerve conduction velocity in iDKO mice. p=0.0186, DM = −34.4` ± 8.984, CI = −59.36 to −9.468, t = 3.83, df = 4. (F) Unpaired t-test. YAP/TAZ+ Schwann cells in iDKO mice. p=0.0018, DM = −62.55 + /- 5.872, CI = −81.24 to −43.86, t = 10.65, df = 3. (G) Unpaired t-test. Demyelinating Schwann cells in iDKO mice. p<0.0001, DM = 21.77 + /- 0.9387, CI = 19.16 to 24.37, t = 23.19, df = 4. Figure 7: (C) Unpaired t-test. Krox20+ Schwann cells in iDKO mice. p=0.0038, DM = −37.02 + /- 4.497, CI = −51.33 to −22.71, t = 8.232, df = 3. Figure 8: (D, E) 2-way ANOVA with Sidak’s multiple comparison test. (D) TEAD1 ChIP from P12-P15 sciatic nerves. E1 primers: p=0.9997, DM = 0.0294, CI = −0.1733 to 0.2321, t = 0.408, df = 44 E2 primers: p=0.9498, DM = 0.0684, CI = −0.1343 to 0.2711, t = 0.9492, df = 44 E3 primers: p=0.1994, DM = 0.2535, CI = −0.06706 to 0.5741, t = 2.225, df = 44 E4 primers: p<0.0001, DM = 0.5356, CI = 0.3329 to 0.7383, t = 7.432, df = 44 E5 primers: p<0.0001, DM = 0.5335, CI = 0.3068 to 0.7602, t = 6.622, df = 44 E6 primers: p=0.9966, DM = 0.0428, CI = −0.1599 to 0.2455, t = 0.5939, df = 44 beta actin primers: p>0.9999, DM = 0.001333, CI = −0.2604 to 0.2631, t = 0.01433, df = 44. (E) TEAD1 ChIP from P70 sciatic nerves. E3 primers: p=0.0001, DM = 0.1019, CI = 0.05544 to 0.1484, t = 6.89, df = 12 E4 primers: p<0.0001, DM = 0.234, CI = 0.1875 to 0.2805, t = 15.82, df = 12 E5 primers: p=0.0498, DM = 0.0465, CI = 4.058e-005 to 0.09296, t = 3.144, df = 12 Krox20 promoter primers: p=0.8830, DM = 0.016, CI = −0.03046 to 0.06246, t = 1.082, df = 12 beta actin primers: p>0.9999, DM = 0.0005, CI = −0.04596 to 0.04696, t = 0.03381, df = 12 Miro1 primers: p>0.9999, DM = 0.001, CI = −0.04546 to 0.04746, t = 0.06761, df = 12. Figure 2—figure supplement 1: (C) 2-way ANOVA, with Sidak’s multiple comparison test. Yap/Taz cDKO, percentage of Schwann cells containing residual YAP/TAZ, P4: p=0.0007, DM = 45.7, CI = 28.87 to 62.53, t = 8.559, df = 5 P60: p=0.0003, DM = 61.5, CI = 43.06 to 79.94, t = 10.51, df = 5. (D) Unpaired t-test. Yap/Taz cDKO vs WT, relative Yap و Taz مستويات مرنا. Yap: p=0.0009, DM = −0.8333 + /- 0.09428, CI = −1.095 to −0.5716, t = 8.839, df = 4 Taz: p=0.0215, DM = −0.45 + /- 0.1458, CI = −0.8067 to −0.0933, t = 3.087, df = 6. Figure 2—figure supplement 2: (B) 2-way ANOVA, with Sidak’s multiple comparison test. Yap/Taz cDKO fore- and hindlimb grip strength. Forelimb, 10 week: p=0.0028, DM = 47.57, CI = 20.23 to 74.9, t = 4.774, df = 8 16 week: p=0.0030, DM = 47.01, CI = 19.67 to 74.34, t = 4.718, df = 8. Hindlimb, 10 week: p=0.0105, DM = 96.98, CI = 26.93 to 167.0, t = 3.798, df = 8 16 week: p=0.0113, DM = 95.68, CI = 25.64 to 165.7, t = 3.747, df = 8. (D) 2-way ANOVA, with Tukey’s multiple comparison test. ياp/Taz cDKO, mice weights, P60: WT female vs Yap/Taz cDKO female, p=0.0005, DM = 4.7, CI = 2.158 to 7.242, q = 7.599, df = 14 WT male vs Yap/Taz cDKO male, p<0.0001, DM = 9.75, CI = 6.636 to 12.86, q = 12.87, df = 14. Figure 2—figure supplement 3. (E) 2-way ANOVA with Sidak’s multiple comparison test. Number of small and large axon bundles containing large axons in Yap/Taz cDKO sciatic nerve. Small bundles (2–5 axons) p<0.0001, DM = −86.1, CI = −105.9 to −66.27, t = 11.91, df = 8 Large bundles (>5 axons) p=0.7342, DM = −5.3, CI = −25.13 to 14.53, t = 0.7331, df = 8. Figure 4—figure supplement 2: (C) Unpaired Student’s t-test. Integrin α6 mRNA levels in Yap/Taz cDKO P60 sciatic nerve. p=0.039, DM = −0.533 + /- 0.1764, CI = −1.023 to −0.04361, t = 3.024, df = 4.


Radiation-induced Reductions in Macrophage Recruitment Have Only Slight Effects on Myelin Degeneration in Sectioned Peripheral Nerves of Mice

Macrophage recruitment into the distal nerve stump of the cut or crushed sciatic or saphenous nerves of C57BL/6J mice was reduced by prior whole body irradiation. This procedure was successful in keeping the numbers of cells stained with the mouse macrophage-specific antibody F4/80 to the levels found in unsectioned nerves. Quantitative image analysis of immunostained sections showed that the rate of loss of myelin basic protein was identical in nerves from irradiated and unirradiated mice up to 5 days but thereafter was slower in macrophage-deprived nerves. Similar analysis of semithin sections stained with toluidine blue detected more undegenerated myelin in the nerves from irradiated mice 10 days after operation. Quantitative counts made from electron micrographs of the sectioned nerves at 7 days also showed slightly less extensive myelin breakdown in the nerves from irradiated mice. Complete removal of myelin from some Schwann cells can occur without macrophages, but macrophages accelerate the removal of myelin in the later stages of Wallerian degeneration. It is concluded that there are two phases to the breakdown of myelin in peripheral nerves undergoing Wallerian degeneration: an initial stage entirely dependent on the activity of Schwann cells and a later stage dependent on both Schwann cells and the presence of macrophages.


Chromatin modifications with convergent or divergent functions in CNS and PNS myelination

Given that diseases like MS do not solely target the myelinating cells of the CNS but extend to the PNS as well, the roles of HDACs have also been studied in Schwann cell development and peripheral myelination. Inhibition of HDACs by TSA promotes Schwann cell proliferation, while inhibiting their maturation, a phenomenon also seen in oligodendrocytes [62, 114] , where oligodendrocyte chromatin generally becomes more dense and likely deacetylated as cells differentiate. Similarly, deletion of both HDAC1 and 2, but not either gene in isolation, causes Schwann cell apoptosis and hypomyelinating phenotype, suggesting overlapping functions in HDAC1 and 2 with regard to Schwann cell development and myelination [115, 116] . Intriguingly, although blocking Schwann cell remyelination, short-term HDAC1/2 inhibition can improve recovery after nerve injury. This is likely due to a capacity Schwann cells do not share with oligodendrocytes, namely conversion into repair cells, which increases the rate axon regrowth at the expense of remyelination [117] .

In contrast to HDAC1/2, HDAC3 appears to exert unique functions distinct from other class I HDACs. Inhibition of HDAC3 seems to promote Schwann cell maturation and enhance myelin sheath growth [4] , suggesting, as in oligodendrocytes, specific functions unique to individual HDAC family members in Schwann cell myelinogenesis. Differing from its early role in oligodendrocyte specification during development [69] , HDAC3 appears to have a later function as an inhibitor of Schwann cell maturation and myelinogenesis [4] . Thus, HDAC3 may have a distinct role in myelinating cell development in the central and peripheral nervous systems, although the potential functions of HDAC3 in myelin growth and repair in the CNS remain to be fully determined. If these temporally-specific divergent functions among class I HDACs are supported in future research, it indicates the caution required in therapeutic administration of broad-spectrum HDACi and the even greater need for highly specific therapies for myelinating cell dysfunction.

The ATP-dependent chromatin remodelers have also been shown to regulate Schwann cell development and PNS myelination. In a subtle contrast to its early role in OPC specification and differentiation [27, 29] , Brg1 is also required for immature Schwann cells to differentiate and for myelin formation في الجسم الحي [118, 119] . As it does for OPCs in the CNS, Brg1 activates Sox10, although in Schwann cells this occurs at the onset of myelination and in cooperation with the transcription factor NF-κB [118] . Brg1 then also interacts with Sox10 to activate Schwann cell maturation and myelination عبر the activation of myelin gene expression [119, 120] .

Although oligodendrocytes and Schwann cells arise from separate progenitors in the neural tube and neural crest, respectively, and utilize anatomically distinct strategies to enwrap target axons (multiple axons for oligodendrocytes and single axons for Schwann cells), chromatin remodelers serve as critical regulators of the myelination program in both cell types. However, the effects of chromatin remodeling may be accomplished through distinct mechanisms, suggesting common and divergent features of chromatin remodeling behind regulation of central and peripheral myelination.


Functional ionotropic glutamate receptors on peripheral axons and myelin

مقدمة: Neurotransmitter-dependent signaling is traditionally restricted to axon terminals. However, receptors are present on myelinating glia, suggesting that chemical transmission may also occur along axons. أساليب: Confocal microscopy and Ca 2+ -imaging using an axonally expressed FRET-based reporter was used to measure Ca 2+ changes and morphological alterations in myelin in response to stimulation of glutamate receptors. نتائج: Activation of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) or ن-methyl-D-aspartate (NMDA) receptors induced a Ca 2+ increase in axon cylinders. However, only the latter caused structural alterations in axons, despite similar Ca 2+ increases. Myelin morphology was significantly altered by NMDA receptor activation, but not by AMPA receptors. Cu 2+ ions influenced the NMDA receptor-dependent response, suggesting that this metal modulates axonal receptors. Glutamate increased ribosomal signal in Schwann cell cytoplasm. الاستنتاجات: Axon cylinders and myelin of peripheral nervous system axons respond to glutamate, with a consequence being an increase in Schwann cell ribosomes. This may have implications for nerve pathology and regeneration. Muscle Nerve 54: 451–459, 2016


Conclusions and future directions

Even though multiple treatment strategies have been explored, including ERT, HCT, and HSC-GT, none of them has proven entirely effective in treating MLD patients, with the peripheral demyelination being the most refractory to therapy. Although many clues have emerged from neuropathological, clinical and genetic studies of MLD and other demyelinating storage diseases, the cellular mechanisms of peripheral polyneuropathy in MLD remain elusive. HSC-GT treated patients clearly seem to benefit from the higher achieved ASA levels, and thereby increased penetration into the PNS, when compared to HCT. However, considering MLD not to be caused by only enzyme deficiency and subsequent sulfatide accumulation, but also by an inflammatory component, might provide important insights into the pathophysiology of the disease and the progression of the peripheral neuropathy after treatment. A neuroinflammatory component in the pathology of the disease is an attractive hypothesis with clear therapeutic implications, but convincing preclinical and clinical evidence has yet to be shown. حيث ARSA knockout mouse models do not show clear demyelination or peripheral neuropathy, the use of double-transgenic mASA2/2 mice [66] is recommended to study inflammation and treatment effects on the PNS.

In order to better understand the clinical impact and possible pathomechanisms of peripheral neuropathy in different stages and forms of MLD, results of repeated PNS measurements in patients, such as nerve conduction velocities, ultrasound and physical exams, could be combined with (historical) nerve pathology findings. Besides, the prevalence and potential role of complement factors and autoantibodies in MLD disease course, e.g. antiganglioside antibodies and anti-myelin-associated glycoprotein antibodies, remains to be explored. Finally, studying whether ARSA variants or biomarkers, such as pro-inflammatory cytokines, are correlated to severity of peripheral neuropathy might help to better predict treatment outcomes and select patients for treatment with either HCT (patients with a low chance on severe peripheral neuropathy) or gene therapy (patients with a high chance on severe peripheral neuropathy).

To improve clinical treatment of MLD patients, the management of PNS symptoms should be included as part of the treatment protocol, as these can be severely debilitating even after treatment. Parents of patients should be counseled on the importance of proper footwear and care to prevent deformities, and signs of neuropathic pain and bladder dysfunction that can be treated with amitriptyline or gabapentin and intermittent catheterization, respectively. In addition, a regular (yearly) screening of peripheral neuropathy is advised in symptomatic MLD patients. Simple questionnaires and diagnostic tests such as pin sensibility, strength and tendon reflexes can provide useful information, but will be difficult to perform in severely affected patients. Nerve conduction studies are needed to objectify uniform slowing of both motor and sensory peripheral nerves. As MLD is a disease affecting both the CNS and PNS, it will be challenging to attribute symptoms and signs to either of the two. Following treated patients with stabilization of brain involvement on MRI will be helpful to examine the impact of peripheral neuropathy.

Other important challenges remain also for both clinicians and researchers. Due to the rarity of MLD and the variability in its presentation, many patients are still diagnosed too late to be considered for treatment. International efforts will be necessary to achieve early diagnosis in order to treat these patients and include them in clinical trials at early stages of disease. MLD patients who receive HCT or gene therapy earlier usually have better outcomes than those treated at later stages of the disease [9, 78, 128]. The identification of several elevated sulfatide species, such as C-16-0-OH and C-16-1-OH, as a potential marker of MLD and of disease progression, and the availability of optimized high-throughput assays to measure these in dried blood spots offer possibilities for newborn screening and pre-symptomatic treatment [129]. Currently, a newborn screening pilot study is conducted in Washington State and detected only four false positives out of 70.000 samples [130]. However, additional data on genotype – phenotype relations and biomarkers to predict disease course, and data on (long-term) effects of treating patients earlier in life, especially on preventing peripheral neuropathy in late-infantile patients, are needed to speed up the implementation.

Since there is no universal standard for assessing patients prior to treatment nor for following them after, such data are needed to define the effects and limitations of treatment options. Currently introduced approaches are the MRI MLD score, the MLD gross motor function (for patients from the age of 18 months onwards), and various intelligence tests at a yearly basis for at least 5 years after treatment [9]. However, these assessments predominantly focus on CNS symptoms. لتقييم الاعتلال العصبي المحيطي سنويًا ، قد تكون النتيجة الإجمالية للاعتلال العصبي المحيطي المعدلة لدى الأطفال [131] بالإضافة إلى دراسات NCV مفيدة أيضًا للأطفال أو مرضى MLD العاجزين. ومع ذلك ، لم يتم التحقق من صحة هذه النتيجة في هذه المجموعة المحددة من المرضى حتى الآن ، ويتم استقراء النصائح حول متابعة الاعتلال العصبي المحيطي في مرضى MLD بشكل أساسي من رأي الخبراء.

أخيرًا ، لا سيما في تجارب التدخل المرتكزة على الخلايا مثل HCT والعلاج الجيني ، يجب أيضًا تنسيق تصميمات التجارب السريرية وبروتوكولات المراقبة لمقارنة نتائج الدراسة على الرغم من الأعداد الصغيرة والتباين في الأنماط الظاهرية للمرض [132]. يفضل مشاركة بروتوكولات التجارب السريرية والنتائج وبيانات الأمراض العصبية وفقًا لنهج العلوم المفتوحة لتعزيز التطوير العلاجي وزيادة التعاون الدولي.


ملخص

في الختام ، فإن SKPs هي سلائف ذات صلة بالقمة العصبية متعددة القدرات وربما مشتقة في الجلد تلعب دورًا مهمًا في استتباب الأعصاب الجلدية. في ظل الظروف الفسيولوجية ، قد تكون SKPs مصدرًا بديلاً للأسلاف لتنمية الأعصاب الجلدية وتجديدها. ومع ذلك ، في ظل الحالة المرضية لـ NF1 ، قد تكون خلايا SKP هي الخلية الأصلية للورم العصبي الليفي الجلدي (الشكل 6). علاوة على ذلك ، فإن توضيح بيولوجيا SKPs سيعطينا فهمًا أفضل لاستتباب العصب الجلدي والأمراض المرتبطة به ، بما في ذلك الاعتلال العصبي المحيطي والحكة والألم وكذلك التسبب في الورم العصبي الليفي.

الأدوار الفسيولوجية والفيزيولوجية المرضية للـ SKPs في الجلد. SKPs هي سلائف متعددة القدرات مرتبطة بـ NCSC في الجلد والتي قد تلعب أدوارًا مهمة في توازن الأعصاب الجلدية. في ظل الظروف الفسيولوجية ، قد يؤدي قطع الأعصاب الجلدية إلى تجنيد SKPs المجاورة في المواقع المصابة وتعزيز تمايز SKPs في خلايا شوان. تفرز خلايا شوان المتكاثرة أيضًا عوامل الجذب الكيميائي التي تجند أنواعًا أخرى من الخلايا ، بما في ذلك الخلايا الليفية التي تخضع لفرز الخلايا ، حيث تنمو خلايا شوان والخلايا الليفية في أعمدة مرتبة على طول الأنبوب الداخلي للعظام ، مما يؤدي إلى إنشاء ممرات خلوية ، تُعرف باسم "عصابات Bungner ،" لتوجيه المحاوير المتجددة عبر الفجوات المصابة [2 ، 3]. من ناحية أخرى ، في ظل الحالة المرضية لـ NF1 ، قد تنتج الخلايا العصبية / الصدمة "عوامل فسيولوجية" تحفز بشكل تفضيلي SKPs على التمايز تجاه سلالة خلايا شوان. أثناء تمايز خلايا شوان ، وفقدان تغاير الزيجوت NF1 التعبير في SKPs أو التمايز المبكر لخلايا شوان ، بالإضافة إلى إشارات البيئة المكروية الأخرى (مثل الهرمونات ، الخلايا العصبية ، الالتهاب) ، يؤدي إلى تكوين الورم الليفي العصبي [29]. يتماشى هذا مع السيناريو السريري البشري ، لأنه من المعروف أن صدمة جلد مرضى NF1 يمكن أن تحفز تكوين الورم الليفي العصبي الجلدي [56]. الاختصارات: NCSCs ، الخلايا الجذعية للقمة العصبية NF1 ، الورم العصبي الليفي من النوع 1 SKPs ، السلائف المشتقة من الجلد.


شاهد الفيديو: خلايا شوان. الأحياء. فسيولوجيا الجهاز العصبي المتقدمة (قد 2022).


تعليقات:

  1. Goltisar

    أوافق ، شيء جيد جدا

  2. Twain

    هذا ما كنت أنتظره! شكراً جزيلاً!

  3. Iphis

    تماما أشارككم رأيك. في شيء ما أعتقد أيضًا ، ما هي الفكرة الممتازة.

  4. Ardell

    في هذا الشيء. قبل أن أفكر خلاف ذلك ، أشكرك على المساعدة في هذا السؤال.



اكتب رسالة